Mutagenetix > Incidental Mutation

Incidental Mutation 'R1829:Dsp'

207145

Institutional Source

Beutler Lab

Gene Symbol

Dsp

Ensembl Gene

ENSMUSG00000054889

Gene Name

desmoplakin

Synonyms

5730453H04Rik, DP, 2300002E22Rik

MMRRC Submission

039856-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1829 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

38151294-38198577 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 38193195 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Arginine at position 1652 (L1652R)

Ref Sequence

ENSEMBL: ENSMUSP00000115062 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000124830] [ENSMUST00000127906]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000124830
AA Change: L1652R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000115062
Gene: ENSMUSG00000054889
AA Change: L1652R

Domain	Start	End	E-Value	Type
Blast:SPEC	193	282	2e-51	BLAST
SPEC	285	385	6.03e-2	SMART
Blast:SPEC	391	557	1e-96	BLAST
Blast:SPEC	783	894	4e-34	BLAST
SPEC	901	1030	1.39e0	SMART
coiled coil region	1033	1370	N/A	INTRINSIC
coiled coil region	1394	1956	N/A	INTRINSIC
low complexity region	1997	2011	N/A	INTRINSIC
PLEC	2021	2057	3.33e-1	SMART
PLEC	2058	2095	3.76e-9	SMART
PLEC	2096	2133	4.09e-10	SMART
PLEC	2134	2171	2.09e-7	SMART
PLEC	2175	2209	4.83e1	SMART
PLEC	2210	2245	5.67e1	SMART
PLEC	2263	2300	1.22e-8	SMART
PLEC	2301	2338	1.16e-9	SMART
PLEC	2339	2376	1.12e-7	SMART
PLEC	2377	2414	1.56e-6	SMART
PLEC	2418	2452	1.42e0	SMART
PLEC	2468	2505	3.7e-8	SMART
low complexity region	2507	2517	N/A	INTRINSIC
PLEC	2519	2556	3.73e-4	SMART
low complexity region	2577	2593	N/A	INTRINSIC
PLEC	2622	2659	1.46e-6	SMART
PLEC	2660	2697	6.69e-15	SMART
PLEC	2698	2735	1.98e2	SMART
PLEC	2736	2773	2.35e-10	SMART
PLEC	2774	2811	1.39e-3	SMART
low complexity region	2835	2860	N/A	INTRINSIC
low complexity region	2867	2879	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000127906

SMART Domains

Protein: ENSMUSP00000117252
Gene: ENSMUSG00000054889

Domain	Start	End	E-Value	Type
Blast:SPEC	193	282	2e-51	BLAST
SPEC	285	385	6.03e-2	SMART
Blast:SPEC	391	557	1e-95	BLAST
Blast:SPEC	783	894	3e-34	BLAST
SPEC	901	1030	1.39e0	SMART
coiled coil region	1033	1357	N/A	INTRINSIC
low complexity region	1398	1412	N/A	INTRINSIC
PLEC	1422	1458	3.33e-1	SMART
PLEC	1459	1496	3.76e-9	SMART
PLEC	1497	1534	4.09e-10	SMART
PLEC	1535	1572	2.09e-7	SMART
PLEC	1576	1610	4.83e1	SMART
PLEC	1611	1646	5.67e1	SMART
PLEC	1664	1701	1.22e-8	SMART
PLEC	1702	1739	1.16e-9	SMART
PLEC	1740	1777	1.12e-7	SMART
PLEC	1778	1815	1.56e-6	SMART
PLEC	1819	1853	1.42e0	SMART
PLEC	1869	1906	3.7e-8	SMART
low complexity region	1908	1918	N/A	INTRINSIC
PLEC	1920	1957	3.73e-4	SMART
low complexity region	1978	1994	N/A	INTRINSIC
PLEC	2023	2060	1.46e-6	SMART
PLEC	2061	2098	6.69e-15	SMART
PLEC	2099	2136	1.98e2	SMART
PLEC	2137	2174	2.35e-10	SMART
PLEC	2175	2212	1.39e-3	SMART
low complexity region	2236	2261	N/A	INTRINSIC
low complexity region	2268	2280	N/A	INTRINSIC

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 91.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that anchors intermediate filaments to desmosomal plaques and forms an obligate component of functional desmosomes. Mutations in this gene are the cause of several cardiomyopathies and keratodermas, including skin fragility-woolly hair syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous targeted null mutants die by embryonic day E6.5 due to instability of desmosomes and tissue integrity; rescue by aggregation with wild-type tetraploid morulae increase embyronic survival with noted major defects in heart muscle, neuroepithelium and epidermis; conditional knockouts that are epidermal-specific have compositionally altered epidermal desmosomes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 114 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
7420426K07Rik	T	A	9: 98,903,393	I37N	possibly damaging	Het
Aars	A	T	8: 111,042,706	D287V	probably damaging	Het
Abca12	A	G	1: 71,295,029	C1105R	probably benign	Het
Abca8b	T	A	11: 109,942,341	N1178Y	probably damaging	Het
Abhd12	A	G	2: 150,843,398	L189P	probably damaging	Het
Acap2	G	T	16: 31,110,934	N435K	probably damaging	Het
Adam6b	G	T	12: 113,489,925	G121C	probably damaging	Het
Adgrb1	C	A	15: 74,580,586	C200*	probably null	Het
Agbl5	T	C	5: 30,903,064	S730P	possibly damaging	Het
Ahsg	G	A	16: 22,892,328		probably benign	Het
Aldh9a1	A	T	1: 167,361,854	K390N	probably benign	Het
Alpk2	T	A	18: 65,294,094	H1857L	possibly damaging	Het
Apip	T	A	2: 103,088,662	N102K	probably benign	Het
Asxl2	T	C	12: 3,457,125	S106P	probably damaging	Het
Atp2b2	G	T	6: 113,773,368	R677S	probably damaging	Het
Barhl1	A	C	2: 28,909,845	M256R	probably damaging	Het
BC025446	T	G	15: 75,216,756		probably null	Het
BC052040	G	T	2: 115,642,692	R101L	possibly damaging	Het
Cacnb2	A	T	2: 14,985,964	Q619L	possibly damaging	Het
Ccdc137	C	T	11: 120,458,212	P23L	probably benign	Het
Cdh11	A	T	8: 102,634,641	N688K	possibly damaging	Het
Cdh18	C	T	15: 23,173,852	P51S	probably damaging	Het
Cfhr1	A	T	1: 139,553,600	Y181N	probably damaging	Het
Chmp3	A	G	6: 71,560,939	D50G	probably benign	Het
Crem	T	C	18: 3,295,037		probably null	Het
Cyb561a3	G	A	19: 10,582,393	W27*	probably null	Het
Cyp2d12	C	A	15: 82,558,056	N297K	possibly damaging	Het
Dclk2	C	T	3: 86,805,639	R503Q	possibly damaging	Het
Dnah12	T	C	14: 26,773,023	L1346P	probably damaging	Het
Dnah12	T	A	14: 26,800,075	N1948K	probably damaging	Het
Dstyk	G	A	1: 132,449,595	S66N	probably benign	Het
Ehhadh	T	C	16: 21,762,178	E688G	probably damaging	Het
Emsy	T	A	7: 98,602,729	H688L	possibly damaging	Het
Emsy	G	T	7: 98,602,730	H688N	possibly damaging	Het
Endod1	A	G	9: 14,356,926	L421P	probably damaging	Het
Fam222b	C	T	11: 78,155,035	P346L	probably damaging	Het
Fam3c	G	A	6: 22,309,437	R182W	probably damaging	Het
Gck	T	C	11: 5,910,984	D29G	probably damaging	Het
Gm10320	C	A	13: 98,489,699	R59L	probably damaging	Het
Gm11127	G	T	17: 36,058,004	F61L	probably damaging	Het
Gm21798	C	T	15: 64,817,826		probably benign	Het
Gm9376	A	G	14: 118,267,545	T130A	possibly damaging	Het
Gpr153	T	A	4: 152,282,392	I334N	possibly damaging	Het
Greb1l	T	C	18: 10,509,314	L542P	probably damaging	Het
Hacl1	T	C	14: 31,640,534	E52G	probably benign	Het
Ice2	A	G	9: 69,407,353	Y128C	probably damaging	Het
Ikzf2	T	A	1: 69,542,287	I121L	probably benign	Het
Ipcef1	C	T	10: 6,919,900	A167T	probably benign	Het
Jakmip2	T	A	18: 43,582,080	D127V	possibly damaging	Het
Jph4	T	C	14: 55,114,911	T122A	probably damaging	Het
Kcns2	A	G	15: 34,838,803	E104G	probably damaging	Het
Lars2	A	C	9: 123,431,917	R384S	probably benign	Het
Lsmem1	T	A	12: 40,185,408	H3L	possibly damaging	Het
Lsmem1	G	T	12: 40,185,409	H3N	possibly damaging	Het
Mfhas1	A	C	8: 35,590,068	S566R	probably benign	Het
Mfhas1	C	G	8: 35,590,248	R626G	probably benign	Het
Mgam	A	G	6: 40,666,892	T585A	probably damaging	Het
Mmp25	T	C	17: 23,640,023	K185E	probably benign	Het
Mtch1	T	C	17: 29,338,776	I243V	probably damaging	Het
Mtcp1	A	T	X: 75,411,665	Y25*	probably null	Het
Mybl2	A	G	2: 163,059,583	T35A	probably benign	Het
Myh11	T	C	16: 14,223,880	E736G	probably damaging	Het
Myh2	T	C	11: 67,176,559	I224T	probably damaging	Het
Mymx	T	C	17: 45,601,833		probably benign	Het
Nek10	A	G	14: 14,863,454		probably null	Het
Nsd1	A	T	13: 55,246,369	K697N	probably damaging	Het
Nynrin	A	G	14: 55,872,947	D1837G	possibly damaging	Het
Olfr115	G	A	17: 37,610,277	T158I	probably benign	Het
Olfr424	T	A	1: 174,137,194	I150N	probably benign	Het
Olfr510	T	A	7: 108,667,644	I76N	probably benign	Het
Olfr593	A	T	7: 103,211,886	T9S	probably benign	Het
Olfr701	A	G	7: 106,819,007	H308R	probably benign	Het
Phf19	T	C	2: 34,911,769	T10A	probably benign	Het
Pkd1	A	T	17: 24,565,584	H368L	probably benign	Het
Plscr2	A	G	9: 92,290,755	R156G	probably damaging	Het
Ppp1r42	G	A	1: 10,000,086	R61C	probably benign	Het
Pptc7	T	G	5: 122,313,616	V45G	probably damaging	Het
Prlhr	G	A	19: 60,467,429	T233I	probably damaging	Het
Reps1	C	T	10: 18,107,714	T435I	probably damaging	Het
Ret	T	A	6: 118,153,951	T1084S	probably damaging	Het
Rgl2	T	A	17: 33,933,621	M402K	probably benign	Het
Rp2	A	G	X: 20,376,915	K43R	probably benign	Het
Rundc3b	A	T	5: 8,579,117	W95R	probably damaging	Het
Samd9l	T	C	6: 3,375,107	D718G	possibly damaging	Het
Scnn1b	G	A	7: 121,902,845	R242H	probably benign	Het
Smad4	G	T	18: 73,641,894	Q445K	probably benign	Het
Smchd1	G	T	17: 71,370,337	P1486T	probably damaging	Het
Snx25	G	T	8: 46,035,632	N895K	possibly damaging	Het
Sox2	A	G	3: 34,650,741	D109G	probably damaging	Het
Stfa2	A	T	16: 36,405,202	N38K	probably damaging	Het
Stfa2	C	A	16: 36,405,211	E35D	possibly damaging	Het
Stfa3	A	G	16: 36,450,661	L87P	probably damaging	Het
Strbp	T	C	2: 37,640,909	D111G	possibly damaging	Het
Supt20	C	A	3: 54,727,658		probably benign	Het
Svep1	A	G	4: 58,096,310	Y1437H	possibly damaging	Het
Tbx4	T	A	11: 85,911,920		probably null	Het
Tmem117	A	T	15: 95,094,551	N364I	probably damaging	Het
Tmem8	T	C	17: 26,122,220	Y766H	probably damaging	Het
Trat1	T	C	16: 48,761,379	E45G	probably damaging	Het
Trpc2	G	A	7: 102,084,119	D92N	probably damaging	Het
Trpm1	G	A	7: 64,226,782	D528N	probably damaging	Het
Ttll9	A	G	2: 153,000,236	S337G	possibly damaging	Het
Utrn	A	T	10: 12,475,274	I355N	probably damaging	Het
Vangl1	A	G	3: 102,163,466	S385P	probably benign	Het
Vmn1r209	A	G	13: 22,806,239	S94P	possibly damaging	Het
Vmn2r28	T	A	7: 5,493,811	Q14L	probably benign	Het
Vps45	A	G	3: 96,047,245		probably null	Het
Wdr48	T	C	9: 119,904,330	V81A	probably benign	Het
Xpnpep2	A	G	X: 48,125,353	N476S	probably benign	Het
Zbtb41	A	T	1: 139,446,922	K707*	probably null	Het
Zfp442	A	C	2: 150,409,063	C306W	probably damaging	Het
Zfp811	T	C	17: 32,798,142	N307S	possibly damaging	Het
Zfp976	A	G	7: 42,616,311	W17R	probably damaging	Het
Zyg11b	T	C	4: 108,266,093	T226A	possibly damaging	Het

Other mutations in Dsp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Dsp	APN	13	38197846	missense	probably damaging	0.99
IGL01337:Dsp	APN	13	38192687	missense	probably benign	0.44
IGL01371:Dsp	APN	13	38193617	missense	probably benign	0.13
IGL01473:Dsp	APN	13	38167571	missense	probably damaging	0.99
IGL01660:Dsp	APN	13	38176495	missense	possibly damaging	0.90
IGL01723:Dsp	APN	13	38179084	missense	probably damaging	1.00
IGL01999:Dsp	APN	13	38181186	missense	probably damaging	0.99
IGL02313:Dsp	APN	13	38196523	nonsense	probably null
IGL02833:Dsp	APN	13	38192921	missense	possibly damaging	0.56
IGL03050:Dsp	APN	13	38188445	splice site	probably benign
IGL03353:Dsp	APN	13	38186695	missense	probably damaging	1.00
R0052:Dsp	UTSW	13	38197364	missense	possibly damaging	0.93
R0052:Dsp	UTSW	13	38197364	missense	possibly damaging	0.93
R0078:Dsp	UTSW	13	38196017	missense	probably benign	0.22
R0230:Dsp	UTSW	13	38197705	missense	probably benign	0.03
R0234:Dsp	UTSW	13	38187893	missense	probably benign	0.13
R0234:Dsp	UTSW	13	38187893	missense	probably benign	0.13
R0285:Dsp	UTSW	13	38172794	missense	probably benign
R0326:Dsp	UTSW	13	38192870	nonsense	probably null
R0332:Dsp	UTSW	13	38182228	nonsense	probably null
R0471:Dsp	UTSW	13	38193350	nonsense	probably null
R0567:Dsp	UTSW	13	38192438	missense	probably benign	0.01
R0611:Dsp	UTSW	13	38187741	missense	probably damaging	1.00
R0718:Dsp	UTSW	13	38196764	missense	possibly damaging	0.80
R0926:Dsp	UTSW	13	38183218	missense	probably damaging	0.97
R1078:Dsp	UTSW	13	38183106	splice site	probably benign
R1183:Dsp	UTSW	13	38191740	nonsense	probably null
R1188:Dsp	UTSW	13	38194963	missense	probably damaging	1.00
R1419:Dsp	UTSW	13	38186695	missense	probably damaging	1.00
R1445:Dsp	UTSW	13	38191931	missense	probably damaging	0.98
R1467:Dsp	UTSW	13	38192712	missense	probably benign	0.00
R1467:Dsp	UTSW	13	38192712	missense	probably benign	0.00
R1478:Dsp	UTSW	13	38181138	missense	probably damaging	1.00
R1568:Dsp	UTSW	13	38175147	missense	probably damaging	1.00
R1572:Dsp	UTSW	13	38195738	missense	probably damaging	1.00
R1676:Dsp	UTSW	13	38193374	nonsense	probably null
R1736:Dsp	UTSW	13	38192990	missense	probably benign	0.01
R1776:Dsp	UTSW	13	38196617	missense	probably damaging	0.99
R1878:Dsp	UTSW	13	38164855	missense	possibly damaging	0.53
R2013:Dsp	UTSW	13	38191458	missense	probably damaging	1.00
R2161:Dsp	UTSW	13	38196451	missense	probably damaging	1.00
R2187:Dsp	UTSW	13	38176407	missense	probably damaging	1.00
R2295:Dsp	UTSW	13	38197046	missense	probably benign	0.28
R2495:Dsp	UTSW	13	38193477	missense	possibly damaging	0.91
R2566:Dsp	UTSW	13	38196404	missense	probably damaging	1.00
R2888:Dsp	UTSW	13	38192248	missense	possibly damaging	0.92
R3012:Dsp	UTSW	13	38193342	missense	possibly damaging	0.61
R3614:Dsp	UTSW	13	38177199	missense	probably damaging	0.98
R3725:Dsp	UTSW	13	38194689	splice site	probably null
R3725:Dsp	UTSW	13	38197618	missense	probably benign	0.00
R3797:Dsp	UTSW	13	38177284	critical splice donor site	probably null
R3841:Dsp	UTSW	13	38197705	missense	probably benign
R4030:Dsp	UTSW	13	38191428	missense	possibly damaging	0.84
R4124:Dsp	UTSW	13	38186713	missense	probably damaging	1.00
R4279:Dsp	UTSW	13	38185231	missense	probably damaging	1.00
R4334:Dsp	UTSW	13	38196664	missense	possibly damaging	0.46
R4419:Dsp	UTSW	13	38195132	missense	probably damaging	1.00
R4615:Dsp	UTSW	13	38191632	missense	probably damaging	0.98
R4627:Dsp	UTSW	13	38168641	missense	probably benign	0.01
R4639:Dsp	UTSW	13	38196784	missense	probably damaging	1.00
R4687:Dsp	UTSW	13	38191619	missense	probably damaging	1.00
R4735:Dsp	UTSW	13	38196040	missense	probably damaging	0.99
R4746:Dsp	UTSW	13	38195104	missense	possibly damaging	0.51
R4772:Dsp	UTSW	13	38167528	nonsense	probably null
R4830:Dsp	UTSW	13	38192864	missense	probably benign
R4850:Dsp	UTSW	13	38192469	missense	probably damaging	1.00
R4959:Dsp	UTSW	13	38191710	missense	probably benign	0.41
R4963:Dsp	UTSW	13	38197870	missense	probably damaging	0.99
R4969:Dsp	UTSW	13	38192910	missense	probably benign	0.00
R4978:Dsp	UTSW	13	38182234	missense	probably damaging	1.00
R4989:Dsp	UTSW	13	38197702	missense	possibly damaging	0.93
R5068:Dsp	UTSW	13	38197123	missense	possibly damaging	0.78
R5069:Dsp	UTSW	13	38197123	missense	possibly damaging	0.78
R5070:Dsp	UTSW	13	38197123	missense	possibly damaging	0.78
R5133:Dsp	UTSW	13	38197702	missense	possibly damaging	0.93
R5138:Dsp	UTSW	13	38183298	missense	probably benign	0.37
R5138:Dsp	UTSW	13	38195845	missense	possibly damaging	0.50
R5153:Dsp	UTSW	13	38182306	missense	probably damaging	1.00
R5199:Dsp	UTSW	13	38192902	nonsense	probably null
R5226:Dsp	UTSW	13	38186770	missense	probably damaging	0.99
R5265:Dsp	UTSW	13	38195183	missense	possibly damaging	0.95
R5371:Dsp	UTSW	13	38194889	missense	probably damaging	0.97
R5484:Dsp	UTSW	13	38184038	missense	possibly damaging	0.48
R5534:Dsp	UTSW	13	38195842	missense	probably benign	0.01
R5569:Dsp	UTSW	13	38192652	missense	probably benign	0.01
R5854:Dsp	UTSW	13	38167501	splice site	probably null
R5910:Dsp	UTSW	13	38192469	missense	possibly damaging	0.95
R5929:Dsp	UTSW	13	38195434	missense	possibly damaging	0.92
R5940:Dsp	UTSW	13	38196026	missense	possibly damaging	0.70
R5948:Dsp	UTSW	13	38195401	missense	possibly damaging	0.95
R5955:Dsp	UTSW	13	38194958	missense	possibly damaging	0.73
R5970:Dsp	UTSW	13	38195702	missense	possibly damaging	0.93
R6054:Dsp	UTSW	13	38167609	missense	probably benign	0.00
R6113:Dsp	UTSW	13	38192047	missense	probably damaging	1.00
R6139:Dsp	UTSW	13	38192406	missense	probably damaging	0.97
R6328:Dsp	UTSW	13	38197006	nonsense	probably null
R6527:Dsp	UTSW	13	38195873	missense	probably damaging	1.00
R6573:Dsp	UTSW	13	38196862	missense	probably damaging	1.00
R6628:Dsp	UTSW	13	38167622	missense	possibly damaging	0.73
R6738:Dsp	UTSW	13	38192210	missense	possibly damaging	0.87
R6898:Dsp	UTSW	13	38192217	missense	possibly damaging	0.59
R6919:Dsp	UTSW	13	38167655	missense	possibly damaging	0.84
R6951:Dsp	UTSW	13	38167646	missense	possibly damaging	0.95
R7017:Dsp	UTSW	13	38186707	missense	probably benign	0.02
R7022:Dsp	UTSW	13	38191740	missense	probably benign	0.06
R7135:Dsp	UTSW	13	38179073	missense	probably damaging	1.00
R7192:Dsp	UTSW	13	38195593	missense	probably benign	0.09
R7211:Dsp	UTSW	13	38188535	critical splice donor site	probably null
R7251:Dsp	UTSW	13	38193548	missense	probably benign	0.02
R7326:Dsp	UTSW	13	38192883	missense	probably benign	0.01
R7369:Dsp	UTSW	13	38197525	missense	possibly damaging	0.82
R7376:Dsp	UTSW	13	38172843	missense	probably damaging	1.00
R7406:Dsp	UTSW	13	38197196	missense	possibly damaging	0.63
R7439:Dsp	UTSW	13	38176502	critical splice donor site	probably null
R7439:Dsp	UTSW	13	38195449	missense	probably benign	0.00
R7441:Dsp	UTSW	13	38195449	missense	probably benign	0.00
R7477:Dsp	UTSW	13	38172863	missense	probably damaging	1.00
R7535:Dsp	UTSW	13	38192789	missense	probably benign	0.05
R7558:Dsp	UTSW	13	38168766	missense	probably benign	0.02
R7600:Dsp	UTSW	13	38191715	missense	probably damaging	1.00
R7616:Dsp	UTSW	13	38191482	missense	probably damaging	0.98
R7702:Dsp	UTSW	13	38175207	missense	possibly damaging	0.83
R7738:Dsp	UTSW	13	38185175	missense	probably damaging	0.97
R7815:Dsp	UTSW	13	38191470	missense	probably benign	0.31
R7882:Dsp	UTSW	13	38184018	missense	possibly damaging	0.76
R7917:Dsp	UTSW	13	38167639	nonsense	probably null
R7971:Dsp	UTSW	13	38192523	missense	probably damaging	0.97
R8104:Dsp	UTSW	13	38168624	missense	probably benign	0.03
R8176:Dsp	UTSW	13	38192810	missense	possibly damaging	0.56
R8303:Dsp	UTSW	13	38197343	missense	probably benign
R8323:Dsp	UTSW	13	38172830	missense	possibly damaging	0.80
R8326:Dsp	UTSW	13	38191635	missense	probably damaging	1.00
R8358:Dsp	UTSW	13	38192481	missense	possibly damaging	0.92
R8410:Dsp	UTSW	13	38196815	missense	possibly damaging	0.94
R8552:Dsp	UTSW	13	38185141	missense	probably damaging	0.98
R8713:Dsp	UTSW	13	38168725	missense	probably damaging	0.99
R8801:Dsp	UTSW	13	38197526	missense	possibly damaging	0.81
R8900:Dsp	UTSW	13	38181179	missense	probably damaging	0.99
R8901:Dsp	UTSW	13	38181179	missense	probably damaging	0.99
R8968:Dsp	UTSW	13	38151620	missense	possibly damaging	0.83
R9014:Dsp	UTSW	13	38192724	missense	possibly damaging	0.83
R9021:Dsp	UTSW	13	38196832	missense	possibly damaging	0.61
R9030:Dsp	UTSW	13	38168697	missense	probably damaging	1.00
R9124:Dsp	UTSW	13	38193300	missense	probably benign	0.42
R9129:Dsp	UTSW	13	38193150	missense	probably benign	0.09
R9143:Dsp	UTSW	13	38193361	missense	probably benign	0.05
R9450:Dsp	UTSW	13	38192403	missense	probably damaging	1.00
R9488:Dsp	UTSW	13	38193242	missense	probably benign	0.04
R9514:Dsp	UTSW	13	38187805	missense	probably benign	0.02
R9789:Dsp	UTSW	13	38183961	missense	probably benign	0.03
R9792:Dsp	UTSW	13	38195518	missense	possibly damaging	0.87
X0023:Dsp	UTSW	13	38197684	missense	probably benign	0.00
X0024:Dsp	UTSW	13	38193255	missense	probably benign	0.04
X0027:Dsp	UTSW	13	38186646	missense	possibly damaging	0.68
X0067:Dsp	UTSW	13	38182312	missense	possibly damaging	0.85
Z1176:Dsp	UTSW	13	38197190	missense	possibly damaging	0.81
Z1177:Dsp	UTSW	13	38151689	missense	probably benign	0.01
Z1177:Dsp	UTSW	13	38192854	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TGAAGAGAACAGCCTCCGAC -3'
(R):5'- CAAGTGTTCCTTGGTCAGGTTC -3'

Sequencing Primer
(F):5'- TCCGACGAGTCCTCCAAGAG -3'
(R):5'- GAGCGACTGTAGCCTTTCGATC -3'

Posted On

2014-06-23