Incidental Mutation 'R1829:Nsd1'
ID 207146
Institutional Source Beutler Lab
Gene Symbol Nsd1
Ensembl Gene ENSMUSG00000021488
Gene Name nuclear receptor-binding SET-domain protein 1
Synonyms KMT3B
MMRRC Submission 039856-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1829 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 55357595-55466138 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 55394182 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 697 (K697N)
Ref Sequence ENSEMBL: ENSMUSP00000097089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099490] [ENSMUST00000224973]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000099490
AA Change: K697N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000097089
Gene: ENSMUSG00000021488
AA Change: K697N

DomainStartEndE-ValueType
low complexity region 177 187 N/A INTRINSIC
low complexity region 281 289 N/A INTRINSIC
PWWP 322 388 1.97e-3 SMART
low complexity region 635 644 N/A INTRINSIC
low complexity region 980 1000 N/A INTRINSIC
low complexity region 1296 1309 N/A INTRINSIC
PHD 1546 1588 4.25e-8 SMART
PHD 1593 1640 3.79e-5 SMART
RING 1594 1639 1.08e-1 SMART
PHD 1641 1694 1.09e1 SMART
PHD 1710 1750 1.02e-10 SMART
PWWP 1755 1817 8.87e-29 SMART
AWS 1891 1942 3.02e-22 SMART
SET 1943 2066 1e-45 SMART
PostSET 2067 2083 3.99e-3 SMART
PHD 2121 2164 1.08e-9 SMART
low complexity region 2224 2237 N/A INTRINSIC
low complexity region 2276 2286 N/A INTRINSIC
low complexity region 2335 2356 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000224973
AA Change: K594N

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a SET domain, 2 LXXLL motifs, 3 nuclear translocation signals (NLSs), 4 plant homeodomain (PHD) finger regions, and a proline-rich region. The encoded protein enhances androgen receptor (AR) transactivation, and this enhancement can be increased further in the presence of other androgen receptor associated coregulators. This protein may act as a nucleus-localized, basic transcriptional factor and also as a bifunctional transcriptional regulator. Mutations of this gene have been associated with Sotos syndrome and Weaver syndrome. One version of childhood acute myeloid leukemia is the result of a cryptic translocation with the breakpoints occurring within nuclear receptor-binding Su-var, enhancer of zeste, and trithorax domain protein 1 on chromosome 5 and nucleoporin, 98-kd on chromosome 11. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit excess apoptosis and retarded growth, fail to complete gastrulation, and are resorbed by embryonic day 10. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars1 A T 8: 111,769,338 (GRCm39) D287V probably damaging Het
Abca12 A G 1: 71,334,188 (GRCm39) C1105R probably benign Het
Abca8b T A 11: 109,833,167 (GRCm39) N1178Y probably damaging Het
Abhd12 A G 2: 150,685,318 (GRCm39) L189P probably damaging Het
Acap2 G T 16: 30,929,752 (GRCm39) N435K probably damaging Het
Adam6b G T 12: 113,453,545 (GRCm39) G121C probably damaging Het
Adgrb1 C A 15: 74,452,435 (GRCm39) C200* probably null Het
Agbl5 T C 5: 31,060,408 (GRCm39) S730P possibly damaging Het
Ahsg G A 16: 22,711,078 (GRCm39) probably benign Het
Aldh9a1 A T 1: 167,189,423 (GRCm39) K390N probably benign Het
Alpk2 T A 18: 65,427,165 (GRCm39) H1857L possibly damaging Het
Apip T A 2: 102,919,007 (GRCm39) N102K probably benign Het
Asxl2 T C 12: 3,507,125 (GRCm39) S106P probably damaging Het
Atp2b2 G T 6: 113,750,329 (GRCm39) R677S probably damaging Het
Barhl1 A C 2: 28,799,857 (GRCm39) M256R probably damaging Het
Cacnb2 A T 2: 14,990,775 (GRCm39) Q619L possibly damaging Het
Ccdc137 C T 11: 120,349,038 (GRCm39) P23L probably benign Het
Cdh11 A T 8: 103,361,273 (GRCm39) N688K possibly damaging Het
Cdh18 C T 15: 23,173,938 (GRCm39) P51S probably damaging Het
Cdin1 G T 2: 115,473,173 (GRCm39) R101L possibly damaging Het
Cfhr1 A T 1: 139,481,338 (GRCm39) Y181N probably damaging Het
Chmp3 A G 6: 71,537,923 (GRCm39) D50G probably benign Het
Crem T C 18: 3,295,037 (GRCm39) probably null Het
Cyb561a3 G A 19: 10,559,757 (GRCm39) W27* probably null Het
Cyp2d12 C A 15: 82,442,257 (GRCm39) N297K possibly damaging Het
Dclk2 C T 3: 86,712,946 (GRCm39) R503Q possibly damaging Het
Dnah12 T A 14: 26,522,032 (GRCm39) N1948K probably damaging Het
Dnah12 T C 14: 26,494,980 (GRCm39) L1346P probably damaging Het
Dsp T G 13: 38,377,171 (GRCm39) L1652R probably damaging Het
Dstyk G A 1: 132,377,333 (GRCm39) S66N probably benign Het
Ehhadh T C 16: 21,580,928 (GRCm39) E688G probably damaging Het
Emsy G T 7: 98,251,937 (GRCm39) H688N possibly damaging Het
Emsy T A 7: 98,251,936 (GRCm39) H688L possibly damaging Het
Endod1 A G 9: 14,268,222 (GRCm39) L421P probably damaging Het
Fam222b C T 11: 78,045,861 (GRCm39) P346L probably damaging Het
Fam3c G A 6: 22,309,436 (GRCm39) R182W probably damaging Het
Gck T C 11: 5,860,984 (GRCm39) D29G probably damaging Het
Gm10320 C A 13: 98,626,207 (GRCm39) R59L probably damaging Het
Gm21798 C T 15: 64,689,675 (GRCm39) probably benign Het
Gm9376 A G 14: 118,504,957 (GRCm39) T130A possibly damaging Het
Gpr153 T A 4: 152,366,849 (GRCm39) I334N possibly damaging Het
Greb1l T C 18: 10,509,314 (GRCm39) L542P probably damaging Het
H2-T15 G T 17: 36,368,896 (GRCm39) F61L probably damaging Het
Hacl1 T C 14: 31,362,491 (GRCm39) E52G probably benign Het
Ice2 A G 9: 69,314,635 (GRCm39) Y128C probably damaging Het
Ikzf2 T A 1: 69,581,446 (GRCm39) I121L probably benign Het
Ipcef1 C T 10: 6,869,900 (GRCm39) A167T probably benign Het
Jakmip2 T A 18: 43,715,145 (GRCm39) D127V possibly damaging Het
Jph4 T C 14: 55,352,368 (GRCm39) T122A probably damaging Het
Kcns2 A G 15: 34,838,949 (GRCm39) E104G probably damaging Het
Lars2 A C 9: 123,260,982 (GRCm39) R384S probably benign Het
Lsmem1 T A 12: 40,235,407 (GRCm39) H3L possibly damaging Het
Lsmem1 G T 12: 40,235,408 (GRCm39) H3N possibly damaging Het
Ly6g2 T G 15: 75,088,605 (GRCm39) probably null Het
Mfhas1 A C 8: 36,057,222 (GRCm39) S566R probably benign Het
Mfhas1 C G 8: 36,057,402 (GRCm39) R626G probably benign Het
Mgam A G 6: 40,643,826 (GRCm39) T585A probably damaging Het
Mmp25 T C 17: 23,858,997 (GRCm39) K185E probably benign Het
Mtch1 T C 17: 29,557,750 (GRCm39) I243V probably damaging Het
Mtcp1 A T X: 74,455,271 (GRCm39) Y25* probably null Het
Mybl2 A G 2: 162,901,503 (GRCm39) T35A probably benign Het
Myh11 T C 16: 14,041,744 (GRCm39) E736G probably damaging Het
Myh2 T C 11: 67,067,385 (GRCm39) I224T probably damaging Het
Mymx T C 17: 45,912,759 (GRCm39) probably benign Het
Nek10 A G 14: 14,863,454 (GRCm38) probably null Het
Nynrin A G 14: 56,110,404 (GRCm39) D1837G possibly damaging Het
Or14j4 G A 17: 37,921,168 (GRCm39) T158I probably benign Het
Or2ag2b A G 7: 106,418,214 (GRCm39) H308R probably benign Het
Or52s1 A T 7: 102,861,093 (GRCm39) T9S probably benign Het
Or5p81 T A 7: 108,266,851 (GRCm39) I76N probably benign Het
Or6k4 T A 1: 173,964,760 (GRCm39) I150N probably benign Het
Pgap6 T C 17: 26,341,194 (GRCm39) Y766H probably damaging Het
Phf19 T C 2: 34,801,781 (GRCm39) T10A probably benign Het
Pkd1 A T 17: 24,784,558 (GRCm39) H368L probably benign Het
Plscr2 A G 9: 92,172,808 (GRCm39) R156G probably damaging Het
Ppp1r42 G A 1: 10,070,311 (GRCm39) R61C probably benign Het
Pptc7 T G 5: 122,451,679 (GRCm39) V45G probably damaging Het
Prlhr G A 19: 60,455,867 (GRCm39) T233I probably damaging Het
Prr23a4 T A 9: 98,785,446 (GRCm39) I37N possibly damaging Het
Reps1 C T 10: 17,983,462 (GRCm39) T435I probably damaging Het
Ret T A 6: 118,130,912 (GRCm39) T1084S probably damaging Het
Rgl2 T A 17: 34,152,595 (GRCm39) M402K probably benign Het
Rp2 A G X: 20,243,154 (GRCm39) K43R probably benign Het
Rundc3b A T 5: 8,629,117 (GRCm39) W95R probably damaging Het
Samd9l T C 6: 3,375,107 (GRCm39) D718G possibly damaging Het
Scnn1b G A 7: 121,502,068 (GRCm39) R242H probably benign Het
Smad4 G T 18: 73,774,965 (GRCm39) Q445K probably benign Het
Smchd1 G T 17: 71,677,332 (GRCm39) P1486T probably damaging Het
Snx25 G T 8: 46,488,669 (GRCm39) N895K possibly damaging Het
Sox2 A G 3: 34,704,890 (GRCm39) D109G probably damaging Het
Stfa2 A T 16: 36,225,564 (GRCm39) N38K probably damaging Het
Stfa2 C A 16: 36,225,573 (GRCm39) E35D possibly damaging Het
Stfa3 A G 16: 36,271,023 (GRCm39) L87P probably damaging Het
Strbp T C 2: 37,530,921 (GRCm39) D111G possibly damaging Het
Supt20 C A 3: 54,635,079 (GRCm39) probably benign Het
Svep1 A G 4: 58,096,310 (GRCm39) Y1437H possibly damaging Het
Tbx4 T A 11: 85,802,746 (GRCm39) probably null Het
Tmem117 A T 15: 94,992,432 (GRCm39) N364I probably damaging Het
Trat1 T C 16: 48,581,742 (GRCm39) E45G probably damaging Het
Trpc2 G A 7: 101,733,326 (GRCm39) D92N probably damaging Het
Trpm1 G A 7: 63,876,530 (GRCm39) D528N probably damaging Het
Ttll9 A G 2: 152,842,156 (GRCm39) S337G possibly damaging Het
Utrn A T 10: 12,351,018 (GRCm39) I355N probably damaging Het
Vangl1 A G 3: 102,070,782 (GRCm39) S385P probably benign Het
Vmn1r209 A G 13: 22,990,409 (GRCm39) S94P possibly damaging Het
Vmn2r28 T A 7: 5,496,810 (GRCm39) Q14L probably benign Het
Vps45 A G 3: 95,954,557 (GRCm39) probably null Het
Wdr48 T C 9: 119,733,396 (GRCm39) V81A probably benign Het
Xpnpep2 A G X: 47,214,230 (GRCm39) N476S probably benign Het
Zbtb41 A T 1: 139,374,660 (GRCm39) K707* probably null Het
Zfp442 A C 2: 150,250,983 (GRCm39) C306W probably damaging Het
Zfp811 T C 17: 33,017,116 (GRCm39) N307S possibly damaging Het
Zfp976 A G 7: 42,265,735 (GRCm39) W17R probably damaging Het
Zyg11b T C 4: 108,123,290 (GRCm39) T226A possibly damaging Het
Other mutations in Nsd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Nsd1 APN 13 55,386,548 (GRCm39) missense probably damaging 1.00
IGL01060:Nsd1 APN 13 55,411,242 (GRCm39) missense probably damaging 1.00
IGL01125:Nsd1 APN 13 55,393,430 (GRCm39) missense probably damaging 1.00
IGL01746:Nsd1 APN 13 55,424,328 (GRCm39) splice site probably null
IGL02437:Nsd1 APN 13 55,461,254 (GRCm39) missense probably damaging 1.00
IGL02530:Nsd1 APN 13 55,450,646 (GRCm39) splice site probably benign
IGL02557:Nsd1 APN 13 55,460,261 (GRCm39) missense probably damaging 1.00
IGL02572:Nsd1 APN 13 55,443,943 (GRCm39) missense probably damaging 1.00
IGL02665:Nsd1 APN 13 55,443,996 (GRCm39) missense probably damaging 1.00
IGL02870:Nsd1 APN 13 55,461,416 (GRCm39) missense probably benign 0.06
IGL03181:Nsd1 APN 13 55,394,858 (GRCm39) missense probably damaging 1.00
Amanuensis UTSW 13 55,409,439 (GRCm39) nonsense probably null
handwriting UTSW 13 55,461,359 (GRCm39) missense
Prothonotary UTSW 13 55,430,570 (GRCm39) missense probably damaging 1.00
scribe UTSW 13 55,439,049 (GRCm39) missense probably damaging 1.00
stenographer UTSW 13 55,446,189 (GRCm39) splice site probably null
PIT4480001:Nsd1 UTSW 13 55,361,731 (GRCm39) missense probably benign 0.11
R0316:Nsd1 UTSW 13 55,361,584 (GRCm39) missense probably damaging 0.98
R0519:Nsd1 UTSW 13 55,460,648 (GRCm39) missense probably benign 0.04
R0542:Nsd1 UTSW 13 55,408,271 (GRCm39) missense possibly damaging 0.93
R0563:Nsd1 UTSW 13 55,394,391 (GRCm39) missense possibly damaging 0.48
R0652:Nsd1 UTSW 13 55,395,399 (GRCm39) missense possibly damaging 0.92
R0906:Nsd1 UTSW 13 55,425,403 (GRCm39) missense probably benign 0.30
R1560:Nsd1 UTSW 13 55,394,533 (GRCm39) nonsense probably null
R1572:Nsd1 UTSW 13 55,394,782 (GRCm39) missense probably damaging 0.98
R1693:Nsd1 UTSW 13 55,395,074 (GRCm39) missense probably benign
R1697:Nsd1 UTSW 13 55,361,872 (GRCm39) critical splice acceptor site probably null
R1720:Nsd1 UTSW 13 55,394,711 (GRCm39) missense probably damaging 0.98
R1834:Nsd1 UTSW 13 55,461,164 (GRCm39) missense possibly damaging 0.52
R1842:Nsd1 UTSW 13 55,394,258 (GRCm39) missense probably damaging 1.00
R1880:Nsd1 UTSW 13 55,361,606 (GRCm39) missense probably damaging 0.99
R2022:Nsd1 UTSW 13 55,361,092 (GRCm39) missense probably damaging 0.99
R2075:Nsd1 UTSW 13 55,458,313 (GRCm39) missense possibly damaging 0.74
R2143:Nsd1 UTSW 13 55,408,210 (GRCm39) missense probably damaging 1.00
R2151:Nsd1 UTSW 13 55,439,049 (GRCm39) missense probably damaging 1.00
R2316:Nsd1 UTSW 13 55,381,779 (GRCm39) missense probably damaging 1.00
R2359:Nsd1 UTSW 13 55,361,524 (GRCm39) missense possibly damaging 0.90
R2361:Nsd1 UTSW 13 55,361,524 (GRCm39) missense possibly damaging 0.90
R2656:Nsd1 UTSW 13 55,394,681 (GRCm39) missense probably damaging 1.00
R2849:Nsd1 UTSW 13 55,361,505 (GRCm39) missense probably damaging 0.99
R3237:Nsd1 UTSW 13 55,460,701 (GRCm39) missense possibly damaging 0.92
R3772:Nsd1 UTSW 13 55,394,486 (GRCm39) missense probably benign 0.00
R3773:Nsd1 UTSW 13 55,394,486 (GRCm39) missense probably benign 0.00
R3849:Nsd1 UTSW 13 55,394,504 (GRCm39) missense probably benign 0.00
R3951:Nsd1 UTSW 13 55,416,267 (GRCm39) missense probably benign 0.05
R4036:Nsd1 UTSW 13 55,361,524 (GRCm39) missense possibly damaging 0.90
R4073:Nsd1 UTSW 13 55,395,541 (GRCm39) missense probably benign 0.28
R4080:Nsd1 UTSW 13 55,449,622 (GRCm39) missense probably damaging 0.96
R4226:Nsd1 UTSW 13 55,408,214 (GRCm39) missense probably damaging 1.00
R4485:Nsd1 UTSW 13 55,393,434 (GRCm39) missense probably benign
R4703:Nsd1 UTSW 13 55,361,876 (GRCm39) missense probably damaging 1.00
R4853:Nsd1 UTSW 13 55,416,317 (GRCm39) missense probably benign 0.30
R4915:Nsd1 UTSW 13 55,424,341 (GRCm39) missense probably benign 0.00
R4915:Nsd1 UTSW 13 55,395,681 (GRCm39) missense possibly damaging 0.65
R5264:Nsd1 UTSW 13 55,395,159 (GRCm39) missense possibly damaging 0.49
R5348:Nsd1 UTSW 13 55,460,147 (GRCm39) missense probably benign 0.00
R5473:Nsd1 UTSW 13 55,395,585 (GRCm39) missense probably damaging 1.00
R5498:Nsd1 UTSW 13 55,361,115 (GRCm39) nonsense probably null
R5503:Nsd1 UTSW 13 55,393,752 (GRCm39) missense probably damaging 1.00
R5511:Nsd1 UTSW 13 55,460,543 (GRCm39) missense probably benign 0.00
R5683:Nsd1 UTSW 13 55,393,961 (GRCm39) missense probably benign 0.00
R5778:Nsd1 UTSW 13 55,454,792 (GRCm39) missense probably damaging 1.00
R5793:Nsd1 UTSW 13 55,395,819 (GRCm39) missense probably benign
R5922:Nsd1 UTSW 13 55,395,288 (GRCm39) missense probably benign 0.01
R5956:Nsd1 UTSW 13 55,411,217 (GRCm39) missense probably damaging 1.00
R6053:Nsd1 UTSW 13 55,441,422 (GRCm39) missense probably damaging 1.00
R6141:Nsd1 UTSW 13 55,439,097 (GRCm39) missense probably damaging 1.00
R6158:Nsd1 UTSW 13 55,393,434 (GRCm39) missense probably benign
R6224:Nsd1 UTSW 13 55,460,945 (GRCm39) missense possibly damaging 0.85
R6396:Nsd1 UTSW 13 55,386,602 (GRCm39) missense probably damaging 1.00
R6598:Nsd1 UTSW 13 55,441,515 (GRCm39) missense possibly damaging 0.94
R7170:Nsd1 UTSW 13 55,409,439 (GRCm39) nonsense probably null
R7205:Nsd1 UTSW 13 55,394,283 (GRCm39) missense probably damaging 1.00
R7215:Nsd1 UTSW 13 55,395,454 (GRCm39) missense probably benign 0.00
R7337:Nsd1 UTSW 13 55,394,022 (GRCm39) missense probably damaging 1.00
R7432:Nsd1 UTSW 13 55,361,187 (GRCm39) missense probably benign
R7638:Nsd1 UTSW 13 55,460,141 (GRCm39) missense probably benign 0.01
R7647:Nsd1 UTSW 13 55,447,648 (GRCm39) missense probably damaging 0.96
R7658:Nsd1 UTSW 13 55,425,452 (GRCm39) missense probably damaging 1.00
R7884:Nsd1 UTSW 13 55,461,068 (GRCm39) missense probably damaging 0.99
R8032:Nsd1 UTSW 13 55,458,196 (GRCm39) missense probably damaging 1.00
R8113:Nsd1 UTSW 13 55,393,434 (GRCm39) missense probably benign
R8152:Nsd1 UTSW 13 55,458,180 (GRCm39) missense possibly damaging 0.49
R8183:Nsd1 UTSW 13 55,460,186 (GRCm39) missense probably damaging 1.00
R8432:Nsd1 UTSW 13 55,395,516 (GRCm39) missense possibly damaging 0.91
R8462:Nsd1 UTSW 13 55,446,189 (GRCm39) splice site probably null
R8469:Nsd1 UTSW 13 55,425,366 (GRCm39) missense possibly damaging 0.76
R8756:Nsd1 UTSW 13 55,461,506 (GRCm39) missense probably benign 0.00
R8867:Nsd1 UTSW 13 55,430,570 (GRCm39) missense probably damaging 1.00
R9035:Nsd1 UTSW 13 55,393,667 (GRCm39) missense possibly damaging 0.79
R9101:Nsd1 UTSW 13 55,461,359 (GRCm39) missense
R9154:Nsd1 UTSW 13 55,361,253 (GRCm39) missense probably damaging 1.00
R9155:Nsd1 UTSW 13 55,361,253 (GRCm39) missense probably damaging 1.00
R9262:Nsd1 UTSW 13 55,394,871 (GRCm39) missense possibly damaging 0.92
R9592:Nsd1 UTSW 13 55,424,355 (GRCm39) missense probably damaging 1.00
R9604:Nsd1 UTSW 13 55,381,807 (GRCm39) missense probably benign 0.25
R9712:Nsd1 UTSW 13 55,393,856 (GRCm39) missense possibly damaging 0.81
R9716:Nsd1 UTSW 13 55,458,313 (GRCm39) missense possibly damaging 0.74
R9787:Nsd1 UTSW 13 55,461,518 (GRCm39) missense probably benign 0.15
Z1088:Nsd1 UTSW 13 55,361,661 (GRCm39) missense possibly damaging 0.83
Z1176:Nsd1 UTSW 13 55,393,338 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTTCTGATGATGGCTGCAG -3'
(R):5'- ATTTGCAAGCCCACCCTTTG -3'

Sequencing Primer
(F):5'- CAGTGACCTGGATCCTACAGAG -3'
(R):5'- AAGCCCACCCTTTGTCAGTGG -3'
Posted On 2014-06-23