Incidental Mutation 'R1829:Adgrb1'
ID 207161
Institutional Source Beutler Lab
Gene Symbol Adgrb1
Ensembl Gene ENSMUSG00000034730
Gene Name adhesion G protein-coupled receptor B1
Synonyms B830018M07Rik, Bai1
MMRRC Submission 039856-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1829 (G1)
Quality Score 175
Status Not validated
Chromosome 15
Chromosomal Location 74388045-74461314 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 74452435 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 200 (C200*)
Ref Sequence ENSEMBL: ENSMUSP00000139428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042035] [ENSMUST00000170845] [ENSMUST00000185682] [ENSMUST00000186360] [ENSMUST00000187485]
AlphaFold Q3UHD1
Predicted Effect probably null
Transcript: ENSMUST00000042035
AA Change: C1140*
SMART Domains Protein: ENSMUSP00000046097
Gene: ENSMUSG00000034730
AA Change: C1140*

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 141 160 N/A INTRINSIC
TSP1 264 315 4.69e-10 SMART
low complexity region 319 329 N/A INTRINSIC
TSP1 357 407 3.5e-9 SMART
TSP1 412 462 3.16e-16 SMART
TSP1 470 520 7.15e-15 SMART
TSP1 525 575 3.11e-15 SMART
HormR 577 643 2.55e-20 SMART
Pfam:GAIN 656 859 1e-46 PFAM
GPS 880 938 1.46e-18 SMART
Pfam:7tm_2 944 1180 3.3e-66 PFAM
SCOP:d1jvr__ 1396 1432 5e-4 SMART
low complexity region 1441 1455 N/A INTRINSIC
low complexity region 1545 1556 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170845
AA Change: C200*
SMART Domains Protein: ENSMUSP00000127122
Gene: ENSMUSG00000034730
AA Change: C200*

DomainStartEndE-ValueType
Pfam:7tm_2 4 240 1.9e-67 PFAM
SCOP:d1jvr__ 456 492 1e-3 SMART
low complexity region 501 515 N/A INTRINSIC
low complexity region 605 616 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000185682
AA Change: C200*
SMART Domains Protein: ENSMUSP00000139428
Gene: ENSMUSG00000034730
AA Change: C200*

DomainStartEndE-ValueType
Pfam:7tm_2 4 240 1.9e-67 PFAM
SCOP:d1jvr__ 456 492 1e-3 SMART
low complexity region 501 515 N/A INTRINSIC
low complexity region 605 616 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186095
Predicted Effect unknown
Transcript: ENSMUST00000186360
AA Change: R1112S
SMART Domains Protein: ENSMUSP00000140362
Gene: ENSMUSG00000034730
AA Change: R1112S

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 141 160 N/A INTRINSIC
TSP1 264 315 2.2e-12 SMART
low complexity region 319 329 N/A INTRINSIC
TSP1 357 407 1.7e-11 SMART
TSP1 412 462 1.5e-18 SMART
TSP1 470 520 3.4e-17 SMART
TSP1 525 575 1.5e-17 SMART
HormR 577 643 1.6e-22 SMART
Pfam:DUF3497 653 874 1.2e-44 PFAM
GPS 880 938 8.9e-21 SMART
Pfam:7tm_2 944 1106 9.6e-43 PFAM
low complexity region 1113 1143 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187485
SMART Domains Protein: ENSMUSP00000140959
Gene: ENSMUSG00000034730

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 141 160 N/A INTRINSIC
TSP1 264 315 2.2e-12 SMART
low complexity region 319 329 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187639
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Angiogenesis is controlled by a local balance between stimulators and inhibitors of new vessel growth and is suppressed under normal physiologic conditions. Angiogenesis has been shown to be essential for growth and metastasis of solid tumors. In order to obtain blood supply for their growth, tumor cells are potently angiogenic and attract new vessels as results of increased secretion of inducers and decreased production of endogenous negative regulators. BAI1 contains at least one 'functional' p53-binding site within an intron, and its expression has been shown to be induced by wildtype p53. There are two other brain-specific angiogenesis inhibitor genes, designated BAI2 and BAI3 which along with BAI1 have similar tissue specificities and structures, however only BAI1 is transcriptionally regulated by p53. BAI1 is postulated to be a member of the secretin receptor family, an inhibitor of angiogenesis and a growth suppressor of glioblastomas [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars1 A T 8: 111,769,338 (GRCm39) D287V probably damaging Het
Abca12 A G 1: 71,334,188 (GRCm39) C1105R probably benign Het
Abca8b T A 11: 109,833,167 (GRCm39) N1178Y probably damaging Het
Abhd12 A G 2: 150,685,318 (GRCm39) L189P probably damaging Het
Acap2 G T 16: 30,929,752 (GRCm39) N435K probably damaging Het
Adam6b G T 12: 113,453,545 (GRCm39) G121C probably damaging Het
Agbl5 T C 5: 31,060,408 (GRCm39) S730P possibly damaging Het
Ahsg G A 16: 22,711,078 (GRCm39) probably benign Het
Aldh9a1 A T 1: 167,189,423 (GRCm39) K390N probably benign Het
Alpk2 T A 18: 65,427,165 (GRCm39) H1857L possibly damaging Het
Apip T A 2: 102,919,007 (GRCm39) N102K probably benign Het
Asxl2 T C 12: 3,507,125 (GRCm39) S106P probably damaging Het
Atp2b2 G T 6: 113,750,329 (GRCm39) R677S probably damaging Het
Barhl1 A C 2: 28,799,857 (GRCm39) M256R probably damaging Het
Cacnb2 A T 2: 14,990,775 (GRCm39) Q619L possibly damaging Het
Ccdc137 C T 11: 120,349,038 (GRCm39) P23L probably benign Het
Cdh11 A T 8: 103,361,273 (GRCm39) N688K possibly damaging Het
Cdh18 C T 15: 23,173,938 (GRCm39) P51S probably damaging Het
Cdin1 G T 2: 115,473,173 (GRCm39) R101L possibly damaging Het
Cfhr1 A T 1: 139,481,338 (GRCm39) Y181N probably damaging Het
Chmp3 A G 6: 71,537,923 (GRCm39) D50G probably benign Het
Crem T C 18: 3,295,037 (GRCm39) probably null Het
Cyb561a3 G A 19: 10,559,757 (GRCm39) W27* probably null Het
Cyp2d12 C A 15: 82,442,257 (GRCm39) N297K possibly damaging Het
Dclk2 C T 3: 86,712,946 (GRCm39) R503Q possibly damaging Het
Dnah12 T A 14: 26,522,032 (GRCm39) N1948K probably damaging Het
Dnah12 T C 14: 26,494,980 (GRCm39) L1346P probably damaging Het
Dsp T G 13: 38,377,171 (GRCm39) L1652R probably damaging Het
Dstyk G A 1: 132,377,333 (GRCm39) S66N probably benign Het
Ehhadh T C 16: 21,580,928 (GRCm39) E688G probably damaging Het
Emsy G T 7: 98,251,937 (GRCm39) H688N possibly damaging Het
Emsy T A 7: 98,251,936 (GRCm39) H688L possibly damaging Het
Endod1 A G 9: 14,268,222 (GRCm39) L421P probably damaging Het
Fam222b C T 11: 78,045,861 (GRCm39) P346L probably damaging Het
Fam3c G A 6: 22,309,436 (GRCm39) R182W probably damaging Het
Gck T C 11: 5,860,984 (GRCm39) D29G probably damaging Het
Gm10320 C A 13: 98,626,207 (GRCm39) R59L probably damaging Het
Gm21798 C T 15: 64,689,675 (GRCm39) probably benign Het
Gm9376 A G 14: 118,504,957 (GRCm39) T130A possibly damaging Het
Gpr153 T A 4: 152,366,849 (GRCm39) I334N possibly damaging Het
Greb1l T C 18: 10,509,314 (GRCm39) L542P probably damaging Het
H2-T15 G T 17: 36,368,896 (GRCm39) F61L probably damaging Het
Hacl1 T C 14: 31,362,491 (GRCm39) E52G probably benign Het
Ice2 A G 9: 69,314,635 (GRCm39) Y128C probably damaging Het
Ikzf2 T A 1: 69,581,446 (GRCm39) I121L probably benign Het
Ipcef1 C T 10: 6,869,900 (GRCm39) A167T probably benign Het
Jakmip2 T A 18: 43,715,145 (GRCm39) D127V possibly damaging Het
Jph4 T C 14: 55,352,368 (GRCm39) T122A probably damaging Het
Kcns2 A G 15: 34,838,949 (GRCm39) E104G probably damaging Het
Lars2 A C 9: 123,260,982 (GRCm39) R384S probably benign Het
Lsmem1 T A 12: 40,235,407 (GRCm39) H3L possibly damaging Het
Lsmem1 G T 12: 40,235,408 (GRCm39) H3N possibly damaging Het
Ly6g2 T G 15: 75,088,605 (GRCm39) probably null Het
Mfhas1 A C 8: 36,057,222 (GRCm39) S566R probably benign Het
Mfhas1 C G 8: 36,057,402 (GRCm39) R626G probably benign Het
Mgam A G 6: 40,643,826 (GRCm39) T585A probably damaging Het
Mmp25 T C 17: 23,858,997 (GRCm39) K185E probably benign Het
Mtch1 T C 17: 29,557,750 (GRCm39) I243V probably damaging Het
Mtcp1 A T X: 74,455,271 (GRCm39) Y25* probably null Het
Mybl2 A G 2: 162,901,503 (GRCm39) T35A probably benign Het
Myh11 T C 16: 14,041,744 (GRCm39) E736G probably damaging Het
Myh2 T C 11: 67,067,385 (GRCm39) I224T probably damaging Het
Mymx T C 17: 45,912,759 (GRCm39) probably benign Het
Nek10 A G 14: 14,863,454 (GRCm38) probably null Het
Nsd1 A T 13: 55,394,182 (GRCm39) K697N probably damaging Het
Nynrin A G 14: 56,110,404 (GRCm39) D1837G possibly damaging Het
Or14j4 G A 17: 37,921,168 (GRCm39) T158I probably benign Het
Or2ag2b A G 7: 106,418,214 (GRCm39) H308R probably benign Het
Or52s1 A T 7: 102,861,093 (GRCm39) T9S probably benign Het
Or5p81 T A 7: 108,266,851 (GRCm39) I76N probably benign Het
Or6k4 T A 1: 173,964,760 (GRCm39) I150N probably benign Het
Pgap6 T C 17: 26,341,194 (GRCm39) Y766H probably damaging Het
Phf19 T C 2: 34,801,781 (GRCm39) T10A probably benign Het
Pkd1 A T 17: 24,784,558 (GRCm39) H368L probably benign Het
Plscr2 A G 9: 92,172,808 (GRCm39) R156G probably damaging Het
Ppp1r42 G A 1: 10,070,311 (GRCm39) R61C probably benign Het
Pptc7 T G 5: 122,451,679 (GRCm39) V45G probably damaging Het
Prlhr G A 19: 60,455,867 (GRCm39) T233I probably damaging Het
Prr23a4 T A 9: 98,785,446 (GRCm39) I37N possibly damaging Het
Reps1 C T 10: 17,983,462 (GRCm39) T435I probably damaging Het
Ret T A 6: 118,130,912 (GRCm39) T1084S probably damaging Het
Rgl2 T A 17: 34,152,595 (GRCm39) M402K probably benign Het
Rp2 A G X: 20,243,154 (GRCm39) K43R probably benign Het
Rundc3b A T 5: 8,629,117 (GRCm39) W95R probably damaging Het
Samd9l T C 6: 3,375,107 (GRCm39) D718G possibly damaging Het
Scnn1b G A 7: 121,502,068 (GRCm39) R242H probably benign Het
Smad4 G T 18: 73,774,965 (GRCm39) Q445K probably benign Het
Smchd1 G T 17: 71,677,332 (GRCm39) P1486T probably damaging Het
Snx25 G T 8: 46,488,669 (GRCm39) N895K possibly damaging Het
Sox2 A G 3: 34,704,890 (GRCm39) D109G probably damaging Het
Stfa2 A T 16: 36,225,564 (GRCm39) N38K probably damaging Het
Stfa2 C A 16: 36,225,573 (GRCm39) E35D possibly damaging Het
Stfa3 A G 16: 36,271,023 (GRCm39) L87P probably damaging Het
Strbp T C 2: 37,530,921 (GRCm39) D111G possibly damaging Het
Supt20 C A 3: 54,635,079 (GRCm39) probably benign Het
Svep1 A G 4: 58,096,310 (GRCm39) Y1437H possibly damaging Het
Tbx4 T A 11: 85,802,746 (GRCm39) probably null Het
Tmem117 A T 15: 94,992,432 (GRCm39) N364I probably damaging Het
Trat1 T C 16: 48,581,742 (GRCm39) E45G probably damaging Het
Trpc2 G A 7: 101,733,326 (GRCm39) D92N probably damaging Het
Trpm1 G A 7: 63,876,530 (GRCm39) D528N probably damaging Het
Ttll9 A G 2: 152,842,156 (GRCm39) S337G possibly damaging Het
Utrn A T 10: 12,351,018 (GRCm39) I355N probably damaging Het
Vangl1 A G 3: 102,070,782 (GRCm39) S385P probably benign Het
Vmn1r209 A G 13: 22,990,409 (GRCm39) S94P possibly damaging Het
Vmn2r28 T A 7: 5,496,810 (GRCm39) Q14L probably benign Het
Vps45 A G 3: 95,954,557 (GRCm39) probably null Het
Wdr48 T C 9: 119,733,396 (GRCm39) V81A probably benign Het
Xpnpep2 A G X: 47,214,230 (GRCm39) N476S probably benign Het
Zbtb41 A T 1: 139,374,660 (GRCm39) K707* probably null Het
Zfp442 A C 2: 150,250,983 (GRCm39) C306W probably damaging Het
Zfp811 T C 17: 33,017,116 (GRCm39) N307S possibly damaging Het
Zfp976 A G 7: 42,265,735 (GRCm39) W17R probably damaging Het
Zyg11b T C 4: 108,123,290 (GRCm39) T226A possibly damaging Het
Other mutations in Adgrb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01525:Adgrb1 APN 15 74,458,684 (GRCm39) missense probably damaging 1.00
IGL01748:Adgrb1 APN 15 74,420,206 (GRCm39) splice site probably benign
IGL01874:Adgrb1 APN 15 74,413,423 (GRCm39) missense possibly damaging 0.95
IGL02040:Adgrb1 APN 15 74,413,424 (GRCm39) missense possibly damaging 0.91
IGL02138:Adgrb1 APN 15 74,401,631 (GRCm39) missense probably damaging 1.00
IGL02149:Adgrb1 APN 15 74,412,326 (GRCm39) missense probably damaging 1.00
IGL02320:Adgrb1 APN 15 74,445,961 (GRCm39) missense probably damaging 1.00
IGL02556:Adgrb1 APN 15 74,458,654 (GRCm39) missense probably damaging 0.99
IGL02637:Adgrb1 APN 15 74,460,143 (GRCm39) splice site probably benign
IGL02678:Adgrb1 APN 15 74,410,177 (GRCm39) missense probably damaging 0.99
IGL02792:Adgrb1 APN 15 74,419,471 (GRCm39) missense probably damaging 0.98
Bunting UTSW 15 74,415,550 (GRCm39) missense probably null 0.94
BB005:Adgrb1 UTSW 15 74,410,170 (GRCm39) missense probably damaging 1.00
BB015:Adgrb1 UTSW 15 74,410,170 (GRCm39) missense probably damaging 1.00
PIT4520001:Adgrb1 UTSW 15 74,413,508 (GRCm39) missense probably damaging 0.99
R0193:Adgrb1 UTSW 15 74,444,005 (GRCm39) missense probably damaging 1.00
R0208:Adgrb1 UTSW 15 74,458,656 (GRCm39) missense probably benign
R0267:Adgrb1 UTSW 15 74,401,238 (GRCm39) missense probably damaging 1.00
R0336:Adgrb1 UTSW 15 74,458,998 (GRCm39) missense probably benign 0.06
R0345:Adgrb1 UTSW 15 74,415,198 (GRCm39) missense probably damaging 0.97
R0533:Adgrb1 UTSW 15 74,413,408 (GRCm39) missense probably damaging 1.00
R0635:Adgrb1 UTSW 15 74,412,741 (GRCm39) missense possibly damaging 0.88
R0729:Adgrb1 UTSW 15 74,420,398 (GRCm39) missense probably damaging 1.00
R0792:Adgrb1 UTSW 15 74,452,466 (GRCm39) missense probably damaging 1.00
R1122:Adgrb1 UTSW 15 74,419,534 (GRCm39) missense probably damaging 0.99
R1295:Adgrb1 UTSW 15 74,421,888 (GRCm39) missense probably damaging 1.00
R1522:Adgrb1 UTSW 15 74,452,466 (GRCm39) missense probably damaging 1.00
R1696:Adgrb1 UTSW 15 74,459,956 (GRCm39) missense probably damaging 1.00
R1707:Adgrb1 UTSW 15 74,401,192 (GRCm39) missense probably damaging 0.99
R1750:Adgrb1 UTSW 15 74,413,676 (GRCm39) missense probably benign 0.23
R1804:Adgrb1 UTSW 15 74,401,389 (GRCm39) missense probably damaging 1.00
R1895:Adgrb1 UTSW 15 74,412,314 (GRCm39) missense probably damaging 1.00
R1970:Adgrb1 UTSW 15 74,411,726 (GRCm39) splice site probably benign
R2114:Adgrb1 UTSW 15 74,412,411 (GRCm39) critical splice donor site probably null
R2133:Adgrb1 UTSW 15 74,401,757 (GRCm39) missense probably damaging 1.00
R2210:Adgrb1 UTSW 15 74,419,553 (GRCm39) missense probably damaging 1.00
R3701:Adgrb1 UTSW 15 74,416,864 (GRCm39) missense probably damaging 0.99
R3770:Adgrb1 UTSW 15 74,460,157 (GRCm39) missense probably damaging 1.00
R3980:Adgrb1 UTSW 15 74,454,792 (GRCm39) missense probably damaging 1.00
R4355:Adgrb1 UTSW 15 74,415,511 (GRCm39) missense probably damaging 1.00
R4412:Adgrb1 UTSW 15 74,449,302 (GRCm39) unclassified probably benign
R4634:Adgrb1 UTSW 15 74,456,278 (GRCm39) utr 3 prime probably benign
R4683:Adgrb1 UTSW 15 74,459,963 (GRCm39) missense probably damaging 1.00
R4742:Adgrb1 UTSW 15 74,401,328 (GRCm39) nonsense probably null
R4760:Adgrb1 UTSW 15 74,443,312 (GRCm39) missense probably damaging 1.00
R4794:Adgrb1 UTSW 15 74,459,978 (GRCm39) missense probably damaging 1.00
R4880:Adgrb1 UTSW 15 74,458,871 (GRCm39) missense possibly damaging 0.85
R4885:Adgrb1 UTSW 15 74,444,011 (GRCm39) missense probably benign 0.04
R5092:Adgrb1 UTSW 15 74,401,664 (GRCm39) missense probably benign 0.39
R5198:Adgrb1 UTSW 15 74,415,550 (GRCm39) missense probably null 0.94
R5225:Adgrb1 UTSW 15 74,449,348 (GRCm39) unclassified probably benign
R5421:Adgrb1 UTSW 15 74,421,876 (GRCm39) missense probably damaging 1.00
R5764:Adgrb1 UTSW 15 74,413,423 (GRCm39) missense possibly damaging 0.95
R5914:Adgrb1 UTSW 15 74,410,219 (GRCm39) missense possibly damaging 0.54
R6035:Adgrb1 UTSW 15 74,412,292 (GRCm39) missense possibly damaging 0.50
R6035:Adgrb1 UTSW 15 74,412,292 (GRCm39) missense possibly damaging 0.50
R6066:Adgrb1 UTSW 15 74,412,308 (GRCm39) missense probably damaging 0.99
R6423:Adgrb1 UTSW 15 74,459,992 (GRCm39) critical splice donor site probably null
R6811:Adgrb1 UTSW 15 74,401,210 (GRCm39) missense probably damaging 1.00
R6945:Adgrb1 UTSW 15 74,421,873 (GRCm39) missense probably damaging 0.99
R7012:Adgrb1 UTSW 15 74,401,750 (GRCm39) missense probably damaging 0.97
R7015:Adgrb1 UTSW 15 74,445,959 (GRCm39) missense probably damaging 1.00
R7061:Adgrb1 UTSW 15 74,441,730 (GRCm39) missense probably benign 0.00
R7209:Adgrb1 UTSW 15 74,441,797 (GRCm39) missense possibly damaging 0.85
R7213:Adgrb1 UTSW 15 74,441,733 (GRCm39) missense probably benign
R7283:Adgrb1 UTSW 15 74,452,512 (GRCm39) missense possibly damaging 0.94
R7329:Adgrb1 UTSW 15 74,411,094 (GRCm39) missense probably damaging 0.99
R7616:Adgrb1 UTSW 15 74,420,418 (GRCm39) missense probably damaging 0.98
R7695:Adgrb1 UTSW 15 74,415,487 (GRCm39) missense possibly damaging 0.95
R7928:Adgrb1 UTSW 15 74,410,170 (GRCm39) missense probably damaging 1.00
R8152:Adgrb1 UTSW 15 74,416,849 (GRCm39) missense probably damaging 0.98
R8152:Adgrb1 UTSW 15 74,413,460 (GRCm39) missense probably benign 0.00
R8198:Adgrb1 UTSW 15 74,411,094 (GRCm39) missense probably damaging 0.99
R8485:Adgrb1 UTSW 15 74,420,153 (GRCm39) missense probably damaging 1.00
R8528:Adgrb1 UTSW 15 74,447,700 (GRCm39) missense possibly damaging 0.51
R8534:Adgrb1 UTSW 15 74,415,357 (GRCm39) missense probably damaging 0.97
R8865:Adgrb1 UTSW 15 74,415,507 (GRCm39) missense possibly damaging 0.75
R9044:Adgrb1 UTSW 15 74,441,748 (GRCm39) missense possibly damaging 0.95
R9098:Adgrb1 UTSW 15 74,415,189 (GRCm39) missense probably damaging 1.00
R9157:Adgrb1 UTSW 15 74,411,624 (GRCm39) missense probably damaging 0.98
R9166:Adgrb1 UTSW 15 74,420,475 (GRCm39) missense probably benign 0.00
R9313:Adgrb1 UTSW 15 74,411,624 (GRCm39) missense probably damaging 0.98
R9445:Adgrb1 UTSW 15 74,435,807 (GRCm39) critical splice acceptor site probably benign
Z1177:Adgrb1 UTSW 15 74,419,532 (GRCm39) missense probably damaging 0.99
Z1177:Adgrb1 UTSW 15 74,413,525 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCAGGGGCTGCTTTGCTC -3'
(R):5'- CTCCAAAGGGTGCTATTCCC -3'

Sequencing Primer
(F):5'- GGCTGCTTTGCTCCGTGC -3'
(R):5'- AACGCTGGCCATGTGATG -3'
Posted On 2014-06-23