Incidental Mutation 'R0115:Ssc5d'
ID 20717
Institutional Source Beutler Lab
Gene Symbol Ssc5d
Ensembl Gene ENSMUSG00000035279
Gene Name scavenger receptor cysteine rich family, 5 domains
Synonyms A430110N23Rik, s5d-srcrb
MMRRC Submission 038401-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0115 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 7
Chromosomal Location 4928820-4947827 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) G to A at 4930880 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047309] [ENSMUST00000057612] [ENSMUST00000207506] [ENSMUST00000207527] [ENSMUST00000207687] [ENSMUST00000208754]
AlphaFold Q8BV57
Predicted Effect probably benign
Transcript: ENSMUST00000047309
SMART Domains Protein: ENSMUSP00000045354
Gene: ENSMUSG00000035285

DomainStartEndE-ValueType
low complexity region 35 51 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
low complexity region 88 97 N/A INTRINSIC
Pfam:Acetyltransf_1 101 186 4.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000057612
SMART Domains Protein: ENSMUSP00000052126
Gene: ENSMUSG00000035279

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
SR 20 120 4.44e-49 SMART
low complexity region 141 155 N/A INTRINSIC
low complexity region 167 182 N/A INTRINSIC
SR 199 299 2.36e-53 SMART
SR 305 405 8.22e-53 SMART
low complexity region 437 462 N/A INTRINSIC
SR 464 565 1.11e-49 SMART
low complexity region 741 755 N/A INTRINSIC
SR 758 858 3.93e-50 SMART
low complexity region 936 957 N/A INTRINSIC
low complexity region 981 1004 N/A INTRINSIC
low complexity region 1018 1035 N/A INTRINSIC
low complexity region 1218 1230 N/A INTRINSIC
low complexity region 1357 1364 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207506
Predicted Effect probably benign
Transcript: ENSMUST00000207527
Predicted Effect probably benign
Transcript: ENSMUST00000207687
Predicted Effect probably benign
Transcript: ENSMUST00000208754
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.2%
  • 20x: 86.0%
Validation Efficiency 98% (98/100)
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik A G 9: 114,108,452 (GRCm39) noncoding transcript Het
Alas1 A T 9: 106,115,451 (GRCm39) probably null Het
Arf5 A G 6: 28,426,075 (GRCm39) Y154C probably damaging Het
Arhgap20 T A 9: 51,750,272 (GRCm39) I344N probably damaging Het
Arhgap30 A C 1: 171,235,516 (GRCm39) E630A possibly damaging Het
B4galt5 A G 2: 167,151,154 (GRCm39) L118P probably damaging Het
Bdp1 A G 13: 100,177,962 (GRCm39) I1969T probably benign Het
Bysl C T 17: 47,921,867 (GRCm39) R77Q probably benign Het
Cap1 A T 4: 122,756,868 (GRCm39) H272Q possibly damaging Het
Ccdc146 T C 5: 21,527,754 (GRCm39) I187M possibly damaging Het
Ccdc192 G A 18: 57,727,214 (GRCm39) probably benign Het
Cdhr18 A G 14: 13,899,571 (GRCm38) V117A probably damaging Het
Cdk13 C A 13: 17,894,079 (GRCm39) A1123S probably damaging Het
Ces5a A T 8: 94,228,811 (GRCm39) M473K probably damaging Het
Chd8 A G 14: 52,474,663 (GRCm39) S123P probably benign Het
Cwc22 G A 2: 77,738,455 (GRCm39) A497V probably damaging Het
Cwh43 T C 5: 73,575,370 (GRCm39) S296P probably damaging Het
Cyp2c50 T A 19: 40,080,837 (GRCm39) probably benign Het
Dlg1 C A 16: 31,624,508 (GRCm39) Y399* probably null Het
Drosha A T 15: 12,846,216 (GRCm39) E92D probably benign Het
Fanca C T 8: 123,995,278 (GRCm39) G1408D probably benign Het
Frem1 T A 4: 82,854,406 (GRCm39) D1621V possibly damaging Het
Frem2 G A 3: 53,563,629 (GRCm39) R293C probably damaging Het
Fut8 T A 12: 77,495,334 (GRCm39) V308D probably damaging Het
Glipr1 A G 10: 111,829,446 (GRCm39) I105T probably benign Het
Glmn A T 5: 107,708,800 (GRCm39) S385T probably benign Het
Gon4l T A 3: 88,802,989 (GRCm39) V1200D probably damaging Het
Gpc1 G A 1: 92,785,221 (GRCm39) D387N probably damaging Het
Gsdmc A G 15: 63,675,486 (GRCm39) Y110H probably damaging Het
Gucy1b1 T A 3: 81,941,698 (GRCm39) H586L probably benign Het
Gucy2e A G 11: 69,127,458 (GRCm39) L5P unknown Het
Hectd4 A G 5: 121,433,569 (GRCm39) probably benign Het
Hmcn1 T A 1: 150,684,398 (GRCm39) I391F possibly damaging Het
Hsf4 A T 8: 105,999,336 (GRCm39) probably null Het
I830077J02Rik G A 3: 105,833,886 (GRCm39) T90M probably damaging Het
Ino80 A T 2: 119,261,497 (GRCm39) H722Q probably damaging Het
Kcnma1 C A 14: 23,364,243 (GRCm39) R980L probably damaging Het
Kif1a A G 1: 92,974,500 (GRCm39) probably benign Het
Klhdc7b A G 15: 89,272,724 (GRCm39) H1202R probably benign Het
Lig3 A G 11: 82,684,761 (GRCm39) D559G probably damaging Het
Lyst T C 13: 13,852,537 (GRCm39) V2179A probably benign Het
Mab21l4 A T 1: 93,087,447 (GRCm39) S135R possibly damaging Het
Mansc4 A G 6: 146,976,725 (GRCm39) I297T possibly damaging Het
Marchf6 A T 15: 31,475,958 (GRCm39) F633I probably benign Het
Marf1 C T 16: 13,960,398 (GRCm39) A549T probably damaging Het
Megf10 G T 18: 57,392,874 (GRCm39) V424L possibly damaging Het
Mfsd13a C T 19: 46,354,943 (GRCm39) T40I probably benign Het
Mib2 A G 4: 155,740,519 (GRCm39) probably benign Het
Mmut C T 17: 41,267,118 (GRCm39) T564M probably damaging Het
Myh8 A G 11: 67,197,090 (GRCm39) probably benign Het
Mypn T C 10: 63,028,159 (GRCm39) probably benign Het
Nf1 G A 11: 79,359,702 (GRCm39) probably null Het
Notch3 T A 17: 32,352,436 (GRCm39) T1866S possibly damaging Het
Or1e30 A G 11: 73,678,141 (GRCm39) I126V possibly damaging Het
Or1o11 C T 17: 37,756,670 (GRCm39) A86V probably benign Het
Or4c102 A T 2: 88,422,999 (GRCm39) I284F probably damaging Het
Or4k51 T A 2: 111,584,930 (GRCm39) M112K probably damaging Het
Pkhd1 A T 1: 20,420,714 (GRCm39) I2464N probably damaging Het
Pkn1 A G 8: 84,397,658 (GRCm39) S817P probably damaging Het
Prkg2 A T 5: 99,142,514 (GRCm39) probably null Het
Prl8a6 T C 13: 27,617,084 (GRCm39) D201G probably benign Het
Psmd1 C T 1: 86,010,993 (GRCm39) T356I possibly damaging Het
Ptk6 G A 2: 180,844,320 (GRCm39) probably benign Het
Ptprn2 T C 12: 117,175,466 (GRCm39) probably benign Het
Rbm42 G A 7: 30,347,200 (GRCm39) T106I probably damaging Het
Rims4 A T 2: 163,706,040 (GRCm39) V198E probably damaging Het
Ripk1 T C 13: 34,193,733 (GRCm39) S32P probably damaging Het
Rorc T C 3: 94,284,916 (GRCm39) probably benign Het
Rpl22l1 T C 3: 28,860,685 (GRCm39) F15L probably damaging Het
Slc6a20a C A 9: 123,507,823 (GRCm39) A17S possibly damaging Het
Sorcs1 A G 19: 50,624,891 (GRCm39) probably benign Het
Sp100 A G 1: 85,577,852 (GRCm39) probably benign Het
Taf11 A G 17: 28,126,635 (GRCm39) L4P probably benign Het
Tm2d3 A G 7: 65,345,082 (GRCm39) probably benign Het
Tmub2 T C 11: 102,179,201 (GRCm39) probably null Het
Trim34a T A 7: 103,897,109 (GRCm39) C58S probably damaging Het
Trpc3 T C 3: 36,678,566 (GRCm39) I840V probably benign Het
Trpm6 T C 19: 18,807,316 (GRCm39) V1020A probably damaging Het
Vmn1r214 T A 13: 23,219,464 (GRCm39) Y319* probably null Het
Vmn1r59 T C 7: 5,457,115 (GRCm39) N215S probably benign Het
Vmn2r74 T C 7: 85,606,564 (GRCm39) M261V probably benign Het
Vmn2r89 T C 14: 51,693,577 (GRCm39) F309S probably damaging Het
Wdr95 A T 5: 149,487,855 (GRCm39) D163V probably damaging Het
Xirp2 T A 2: 67,340,253 (GRCm39) F831L possibly damaging Het
Ythdc2 C T 18: 44,974,490 (GRCm39) probably benign Het
Other mutations in Ssc5d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Ssc5d APN 7 4,947,480 (GRCm39) missense possibly damaging 0.63
IGL00939:Ssc5d APN 7 4,939,280 (GRCm39) missense possibly damaging 0.89
IGL01109:Ssc5d APN 7 4,940,111 (GRCm39) nonsense probably null
IGL01409:Ssc5d APN 7 4,945,808 (GRCm39) missense probably benign 0.16
IGL01880:Ssc5d APN 7 4,936,218 (GRCm39) missense probably damaging 1.00
IGL02013:Ssc5d APN 7 4,946,835 (GRCm39) missense probably benign 0.00
IGL02227:Ssc5d APN 7 4,936,453 (GRCm39) critical splice donor site probably null
IGL02963:Ssc5d APN 7 4,947,326 (GRCm39) missense probably benign 0.02
D4043:Ssc5d UTSW 7 4,946,982 (GRCm39) missense possibly damaging 0.70
D4216:Ssc5d UTSW 7 4,946,982 (GRCm39) missense possibly damaging 0.70
R0104:Ssc5d UTSW 7 4,939,285 (GRCm39) missense probably benign 0.41
R0201:Ssc5d UTSW 7 4,947,662 (GRCm39) missense probably benign
R0365:Ssc5d UTSW 7 4,931,466 (GRCm39) nonsense probably null
R0485:Ssc5d UTSW 7 4,940,470 (GRCm39) missense probably damaging 0.99
R0967:Ssc5d UTSW 7 4,947,342 (GRCm39) nonsense probably null
R1607:Ssc5d UTSW 7 4,947,042 (GRCm39) missense probably benign 0.25
R1639:Ssc5d UTSW 7 4,931,416 (GRCm39) missense probably damaging 1.00
R1801:Ssc5d UTSW 7 4,939,606 (GRCm39) missense probably benign 0.05
R1867:Ssc5d UTSW 7 4,931,506 (GRCm39) missense probably damaging 1.00
R1999:Ssc5d UTSW 7 4,945,713 (GRCm39) missense possibly damaging 0.86
R2007:Ssc5d UTSW 7 4,931,628 (GRCm39) missense probably damaging 1.00
R2084:Ssc5d UTSW 7 4,940,011 (GRCm39) missense probably benign 0.01
R2234:Ssc5d UTSW 7 4,946,849 (GRCm39) missense probably benign
R2259:Ssc5d UTSW 7 4,946,915 (GRCm39) missense probably benign 0.01
R2567:Ssc5d UTSW 7 4,939,334 (GRCm39) missense probably damaging 1.00
R2879:Ssc5d UTSW 7 4,939,906 (GRCm39) critical splice acceptor site probably null
R3782:Ssc5d UTSW 7 4,945,790 (GRCm39) missense probably benign 0.00
R3875:Ssc5d UTSW 7 4,930,261 (GRCm39) missense probably damaging 1.00
R4322:Ssc5d UTSW 7 4,931,449 (GRCm39) missense probably damaging 1.00
R4331:Ssc5d UTSW 7 4,945,725 (GRCm39) missense probably benign 0.00
R4334:Ssc5d UTSW 7 4,946,663 (GRCm39) missense probably benign
R4430:Ssc5d UTSW 7 4,946,663 (GRCm39) missense probably benign
R4619:Ssc5d UTSW 7 4,932,524 (GRCm39) missense probably damaging 1.00
R4794:Ssc5d UTSW 7 4,946,744 (GRCm39) missense probably benign
R5106:Ssc5d UTSW 7 4,939,664 (GRCm39) missense probably benign 0.31
R5174:Ssc5d UTSW 7 4,930,970 (GRCm39) missense possibly damaging 0.83
R5553:Ssc5d UTSW 7 4,939,289 (GRCm39) missense probably damaging 1.00
R5649:Ssc5d UTSW 7 4,929,517 (GRCm39) critical splice donor site probably null
R5786:Ssc5d UTSW 7 4,939,817 (GRCm39) missense probably benign 0.00
R6059:Ssc5d UTSW 7 4,945,743 (GRCm39) missense possibly damaging 0.86
R6163:Ssc5d UTSW 7 4,930,253 (GRCm39) missense probably damaging 1.00
R6332:Ssc5d UTSW 7 4,940,521 (GRCm39) missense probably damaging 1.00
R6341:Ssc5d UTSW 7 4,939,664 (GRCm39) missense probably benign 0.31
R6613:Ssc5d UTSW 7 4,936,292 (GRCm39) missense possibly damaging 0.82
R7180:Ssc5d UTSW 7 4,939,600 (GRCm39) missense probably benign 0.17
R7576:Ssc5d UTSW 7 4,931,572 (GRCm39) missense probably damaging 1.00
R7602:Ssc5d UTSW 7 4,945,745 (GRCm39) missense possibly damaging 0.95
R7609:Ssc5d UTSW 7 4,930,575 (GRCm39) missense possibly damaging 0.56
R7691:Ssc5d UTSW 7 4,947,168 (GRCm39) missense probably benign 0.29
R7759:Ssc5d UTSW 7 4,940,529 (GRCm39) nonsense probably null
R8480:Ssc5d UTSW 7 4,939,328 (GRCm39) missense probably damaging 1.00
R9029:Ssc5d UTSW 7 4,930,919 (GRCm39) missense probably damaging 0.97
R9163:Ssc5d UTSW 7 4,936,432 (GRCm39) missense probably damaging 1.00
R9178:Ssc5d UTSW 7 4,930,058 (GRCm39) missense probably damaging 1.00
R9181:Ssc5d UTSW 7 4,945,814 (GRCm39) missense possibly damaging 0.86
R9382:Ssc5d UTSW 7 4,930,283 (GRCm39) critical splice donor site probably null
R9489:Ssc5d UTSW 7 4,940,599 (GRCm39) missense probably benign 0.02
R9626:Ssc5d UTSW 7 4,946,568 (GRCm39) missense probably benign
R9630:Ssc5d UTSW 7 4,939,426 (GRCm39) missense probably damaging 1.00
R9776:Ssc5d UTSW 7 4,932,367 (GRCm39) missense probably benign 0.07
X0063:Ssc5d UTSW 7 4,939,286 (GRCm39) missense probably damaging 1.00
Z1088:Ssc5d UTSW 7 4,931,433 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGGAAATTCAGGCATCCCAGCTC -3'
(R):5'- CTCGTAGCACACAGATCAGGAAGAC -3'

Sequencing Primer
(F):5'- GAGAAGATTCAATGTCCCTGCTG -3'
(R):5'- CAGGGAAATGTAGAGCCTTACC -3'
Posted On 2013-04-11