Incidental Mutation 'R1829:Acap2'
ID 207170
Institutional Source Beutler Lab
Gene Symbol Acap2
Ensembl Gene ENSMUSG00000049076
Gene Name ArfGAP with coiled-coil, ankyrin repeat and PH domains 2
Synonyms Centb2, 9530039J15Rik
MMRRC Submission 039856-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.150) question?
Stock # R1829 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 30911230-31020063 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 30929752 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 435 (N435K)
Ref Sequence ENSEMBL: ENSMUSP00000154852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058033] [ENSMUST00000229010] [ENSMUST00000230614] [ENSMUST00000230698] [ENSMUST00000231125]
AlphaFold Q6ZQK5
Predicted Effect probably damaging
Transcript: ENSMUST00000058033
AA Change: N410K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061501
Gene: ENSMUSG00000049076
AA Change: N410K

DomainStartEndE-ValueType
Pfam:BAR_3 5 238 9.1e-96 PFAM
PH 267 363 1.73e-17 SMART
ArfGap 399 520 2.23e-63 SMART
ANK 632 661 6.71e-2 SMART
ANK 665 694 3.04e0 SMART
ANK 698 727 6.64e2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000229010
AA Change: N428K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000230614
AA Change: N428K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000230698
Predicted Effect probably damaging
Transcript: ENSMUST00000231125
AA Change: N435K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars1 A T 8: 111,769,338 (GRCm39) D287V probably damaging Het
Abca12 A G 1: 71,334,188 (GRCm39) C1105R probably benign Het
Abca8b T A 11: 109,833,167 (GRCm39) N1178Y probably damaging Het
Abhd12 A G 2: 150,685,318 (GRCm39) L189P probably damaging Het
Adam6b G T 12: 113,453,545 (GRCm39) G121C probably damaging Het
Adgrb1 C A 15: 74,452,435 (GRCm39) C200* probably null Het
Agbl5 T C 5: 31,060,408 (GRCm39) S730P possibly damaging Het
Ahsg G A 16: 22,711,078 (GRCm39) probably benign Het
Aldh9a1 A T 1: 167,189,423 (GRCm39) K390N probably benign Het
Alpk2 T A 18: 65,427,165 (GRCm39) H1857L possibly damaging Het
Apip T A 2: 102,919,007 (GRCm39) N102K probably benign Het
Asxl2 T C 12: 3,507,125 (GRCm39) S106P probably damaging Het
Atp2b2 G T 6: 113,750,329 (GRCm39) R677S probably damaging Het
Barhl1 A C 2: 28,799,857 (GRCm39) M256R probably damaging Het
Cacnb2 A T 2: 14,990,775 (GRCm39) Q619L possibly damaging Het
Ccdc137 C T 11: 120,349,038 (GRCm39) P23L probably benign Het
Cdh11 A T 8: 103,361,273 (GRCm39) N688K possibly damaging Het
Cdh18 C T 15: 23,173,938 (GRCm39) P51S probably damaging Het
Cdin1 G T 2: 115,473,173 (GRCm39) R101L possibly damaging Het
Cfhr1 A T 1: 139,481,338 (GRCm39) Y181N probably damaging Het
Chmp3 A G 6: 71,537,923 (GRCm39) D50G probably benign Het
Crem T C 18: 3,295,037 (GRCm39) probably null Het
Cyb561a3 G A 19: 10,559,757 (GRCm39) W27* probably null Het
Cyp2d12 C A 15: 82,442,257 (GRCm39) N297K possibly damaging Het
Dclk2 C T 3: 86,712,946 (GRCm39) R503Q possibly damaging Het
Dnah12 T A 14: 26,522,032 (GRCm39) N1948K probably damaging Het
Dnah12 T C 14: 26,494,980 (GRCm39) L1346P probably damaging Het
Dsp T G 13: 38,377,171 (GRCm39) L1652R probably damaging Het
Dstyk G A 1: 132,377,333 (GRCm39) S66N probably benign Het
Ehhadh T C 16: 21,580,928 (GRCm39) E688G probably damaging Het
Emsy G T 7: 98,251,937 (GRCm39) H688N possibly damaging Het
Emsy T A 7: 98,251,936 (GRCm39) H688L possibly damaging Het
Endod1 A G 9: 14,268,222 (GRCm39) L421P probably damaging Het
Fam222b C T 11: 78,045,861 (GRCm39) P346L probably damaging Het
Fam3c G A 6: 22,309,436 (GRCm39) R182W probably damaging Het
Gck T C 11: 5,860,984 (GRCm39) D29G probably damaging Het
Gm10320 C A 13: 98,626,207 (GRCm39) R59L probably damaging Het
Gm21798 C T 15: 64,689,675 (GRCm39) probably benign Het
Gm9376 A G 14: 118,504,957 (GRCm39) T130A possibly damaging Het
Gpr153 T A 4: 152,366,849 (GRCm39) I334N possibly damaging Het
Greb1l T C 18: 10,509,314 (GRCm39) L542P probably damaging Het
H2-T15 G T 17: 36,368,896 (GRCm39) F61L probably damaging Het
Hacl1 T C 14: 31,362,491 (GRCm39) E52G probably benign Het
Ice2 A G 9: 69,314,635 (GRCm39) Y128C probably damaging Het
Ikzf2 T A 1: 69,581,446 (GRCm39) I121L probably benign Het
Ipcef1 C T 10: 6,869,900 (GRCm39) A167T probably benign Het
Jakmip2 T A 18: 43,715,145 (GRCm39) D127V possibly damaging Het
Jph4 T C 14: 55,352,368 (GRCm39) T122A probably damaging Het
Kcns2 A G 15: 34,838,949 (GRCm39) E104G probably damaging Het
Lars2 A C 9: 123,260,982 (GRCm39) R384S probably benign Het
Lsmem1 T A 12: 40,235,407 (GRCm39) H3L possibly damaging Het
Lsmem1 G T 12: 40,235,408 (GRCm39) H3N possibly damaging Het
Ly6g2 T G 15: 75,088,605 (GRCm39) probably null Het
Mfhas1 A C 8: 36,057,222 (GRCm39) S566R probably benign Het
Mfhas1 C G 8: 36,057,402 (GRCm39) R626G probably benign Het
Mgam A G 6: 40,643,826 (GRCm39) T585A probably damaging Het
Mmp25 T C 17: 23,858,997 (GRCm39) K185E probably benign Het
Mtch1 T C 17: 29,557,750 (GRCm39) I243V probably damaging Het
Mtcp1 A T X: 74,455,271 (GRCm39) Y25* probably null Het
Mybl2 A G 2: 162,901,503 (GRCm39) T35A probably benign Het
Myh11 T C 16: 14,041,744 (GRCm39) E736G probably damaging Het
Myh2 T C 11: 67,067,385 (GRCm39) I224T probably damaging Het
Mymx T C 17: 45,912,759 (GRCm39) probably benign Het
Nek10 A G 14: 14,863,454 (GRCm38) probably null Het
Nsd1 A T 13: 55,394,182 (GRCm39) K697N probably damaging Het
Nynrin A G 14: 56,110,404 (GRCm39) D1837G possibly damaging Het
Or14j4 G A 17: 37,921,168 (GRCm39) T158I probably benign Het
Or2ag2b A G 7: 106,418,214 (GRCm39) H308R probably benign Het
Or52s1 A T 7: 102,861,093 (GRCm39) T9S probably benign Het
Or5p81 T A 7: 108,266,851 (GRCm39) I76N probably benign Het
Or6k4 T A 1: 173,964,760 (GRCm39) I150N probably benign Het
Pgap6 T C 17: 26,341,194 (GRCm39) Y766H probably damaging Het
Phf19 T C 2: 34,801,781 (GRCm39) T10A probably benign Het
Pkd1 A T 17: 24,784,558 (GRCm39) H368L probably benign Het
Plscr2 A G 9: 92,172,808 (GRCm39) R156G probably damaging Het
Ppp1r42 G A 1: 10,070,311 (GRCm39) R61C probably benign Het
Pptc7 T G 5: 122,451,679 (GRCm39) V45G probably damaging Het
Prlhr G A 19: 60,455,867 (GRCm39) T233I probably damaging Het
Prr23a4 T A 9: 98,785,446 (GRCm39) I37N possibly damaging Het
Reps1 C T 10: 17,983,462 (GRCm39) T435I probably damaging Het
Ret T A 6: 118,130,912 (GRCm39) T1084S probably damaging Het
Rgl2 T A 17: 34,152,595 (GRCm39) M402K probably benign Het
Rp2 A G X: 20,243,154 (GRCm39) K43R probably benign Het
Rundc3b A T 5: 8,629,117 (GRCm39) W95R probably damaging Het
Samd9l T C 6: 3,375,107 (GRCm39) D718G possibly damaging Het
Scnn1b G A 7: 121,502,068 (GRCm39) R242H probably benign Het
Smad4 G T 18: 73,774,965 (GRCm39) Q445K probably benign Het
Smchd1 G T 17: 71,677,332 (GRCm39) P1486T probably damaging Het
Snx25 G T 8: 46,488,669 (GRCm39) N895K possibly damaging Het
Sox2 A G 3: 34,704,890 (GRCm39) D109G probably damaging Het
Stfa2 A T 16: 36,225,564 (GRCm39) N38K probably damaging Het
Stfa2 C A 16: 36,225,573 (GRCm39) E35D possibly damaging Het
Stfa3 A G 16: 36,271,023 (GRCm39) L87P probably damaging Het
Strbp T C 2: 37,530,921 (GRCm39) D111G possibly damaging Het
Supt20 C A 3: 54,635,079 (GRCm39) probably benign Het
Svep1 A G 4: 58,096,310 (GRCm39) Y1437H possibly damaging Het
Tbx4 T A 11: 85,802,746 (GRCm39) probably null Het
Tmem117 A T 15: 94,992,432 (GRCm39) N364I probably damaging Het
Trat1 T C 16: 48,581,742 (GRCm39) E45G probably damaging Het
Trpc2 G A 7: 101,733,326 (GRCm39) D92N probably damaging Het
Trpm1 G A 7: 63,876,530 (GRCm39) D528N probably damaging Het
Ttll9 A G 2: 152,842,156 (GRCm39) S337G possibly damaging Het
Utrn A T 10: 12,351,018 (GRCm39) I355N probably damaging Het
Vangl1 A G 3: 102,070,782 (GRCm39) S385P probably benign Het
Vmn1r209 A G 13: 22,990,409 (GRCm39) S94P possibly damaging Het
Vmn2r28 T A 7: 5,496,810 (GRCm39) Q14L probably benign Het
Vps45 A G 3: 95,954,557 (GRCm39) probably null Het
Wdr48 T C 9: 119,733,396 (GRCm39) V81A probably benign Het
Xpnpep2 A G X: 47,214,230 (GRCm39) N476S probably benign Het
Zbtb41 A T 1: 139,374,660 (GRCm39) K707* probably null Het
Zfp442 A C 2: 150,250,983 (GRCm39) C306W probably damaging Het
Zfp811 T C 17: 33,017,116 (GRCm39) N307S possibly damaging Het
Zfp976 A G 7: 42,265,735 (GRCm39) W17R probably damaging Het
Zyg11b T C 4: 108,123,290 (GRCm39) T226A possibly damaging Het
Other mutations in Acap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00533:Acap2 APN 16 30,958,293 (GRCm39) missense probably damaging 1.00
IGL01330:Acap2 APN 16 30,973,495 (GRCm39) missense probably damaging 1.00
IGL01420:Acap2 APN 16 30,920,637 (GRCm39) splice site probably benign
IGL02064:Acap2 APN 16 30,946,146 (GRCm39) missense probably damaging 1.00
IGL02173:Acap2 APN 16 30,926,965 (GRCm39) missense possibly damaging 0.68
IGL02453:Acap2 APN 16 30,950,075 (GRCm39) splice site probably null
IGL02883:Acap2 APN 16 30,915,163 (GRCm39) unclassified probably benign
IGL03203:Acap2 APN 16 30,915,163 (GRCm39) unclassified probably benign
IGL03342:Acap2 APN 16 30,924,310 (GRCm39) missense probably damaging 1.00
R1251:Acap2 UTSW 16 30,926,989 (GRCm39) missense probably damaging 1.00
R1377:Acap2 UTSW 16 30,934,869 (GRCm39) missense probably damaging 1.00
R1432:Acap2 UTSW 16 30,929,901 (GRCm39) missense probably damaging 1.00
R1546:Acap2 UTSW 16 30,923,754 (GRCm39) nonsense probably null
R1594:Acap2 UTSW 16 30,946,205 (GRCm39) missense probably benign 0.01
R1853:Acap2 UTSW 16 30,936,122 (GRCm39) missense probably damaging 1.00
R1970:Acap2 UTSW 16 30,952,345 (GRCm39) critical splice donor site probably null
R2023:Acap2 UTSW 16 30,938,233 (GRCm39) missense probably damaging 0.99
R2086:Acap2 UTSW 16 30,929,763 (GRCm39) missense probably damaging 1.00
R2145:Acap2 UTSW 16 30,924,342 (GRCm39) missense probably benign
R2177:Acap2 UTSW 16 30,952,346 (GRCm39) critical splice donor site probably null
R2214:Acap2 UTSW 16 30,926,946 (GRCm39) missense probably benign 0.19
R2392:Acap2 UTSW 16 30,958,458 (GRCm39) missense probably damaging 0.99
R2438:Acap2 UTSW 16 30,936,133 (GRCm39) missense probably damaging 1.00
R2913:Acap2 UTSW 16 30,934,887 (GRCm39) missense probably damaging 0.99
R4207:Acap2 UTSW 16 30,938,245 (GRCm39) missense probably damaging 0.99
R4274:Acap2 UTSW 16 30,926,932 (GRCm39) missense probably benign 0.01
R4814:Acap2 UTSW 16 30,926,944 (GRCm39) missense probably benign
R4860:Acap2 UTSW 16 30,922,317 (GRCm39) missense possibly damaging 0.92
R4860:Acap2 UTSW 16 30,922,317 (GRCm39) missense possibly damaging 0.92
R5310:Acap2 UTSW 16 30,952,427 (GRCm39) missense probably benign 0.00
R5345:Acap2 UTSW 16 30,926,944 (GRCm39) missense probably benign
R5388:Acap2 UTSW 16 30,928,543 (GRCm39) missense probably damaging 1.00
R5551:Acap2 UTSW 16 30,923,726 (GRCm39) missense probably damaging 1.00
R5578:Acap2 UTSW 16 30,926,932 (GRCm39) missense probably benign 0.00
R6341:Acap2 UTSW 16 30,924,364 (GRCm39) missense possibly damaging 0.86
R6659:Acap2 UTSW 16 30,950,133 (GRCm39) missense probably damaging 0.99
R6977:Acap2 UTSW 16 30,936,079 (GRCm39) missense probably damaging 1.00
R7262:Acap2 UTSW 16 30,946,137 (GRCm39) critical splice donor site probably null
R7304:Acap2 UTSW 16 30,926,934 (GRCm39) missense probably benign 0.05
R7310:Acap2 UTSW 16 30,926,972 (GRCm39) nonsense probably null
R7318:Acap2 UTSW 16 30,946,155 (GRCm39) missense probably damaging 1.00
R7514:Acap2 UTSW 16 30,973,385 (GRCm39) splice site probably null
R7875:Acap2 UTSW 16 30,958,459 (GRCm39) missense probably damaging 0.99
R8256:Acap2 UTSW 16 30,958,287 (GRCm39) critical splice donor site probably null
R9026:Acap2 UTSW 16 30,925,906 (GRCm39) missense probably damaging 0.99
R9177:Acap2 UTSW 16 30,955,392 (GRCm39) missense probably damaging 1.00
R9252:Acap2 UTSW 16 30,920,641 (GRCm39) critical splice donor site probably null
R9268:Acap2 UTSW 16 30,955,392 (GRCm39) missense probably damaging 1.00
R9329:Acap2 UTSW 16 30,946,238 (GRCm39) missense probably damaging 1.00
R9467:Acap2 UTSW 16 30,929,901 (GRCm39) missense possibly damaging 0.54
R9528:Acap2 UTSW 16 30,929,908 (GRCm39) missense possibly damaging 0.75
R9762:Acap2 UTSW 16 30,929,763 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATCCTCTGTGGTCATTAATGAATG -3'
(R):5'- CAGAAATTGGATAAGAAGTCGTCC -3'

Sequencing Primer
(F):5'- ATGATGAACCAAAGTCATCAAAAAC -3'
(R):5'- TTGGATAAGAAGTCGTCCCCATC -3'
Posted On 2014-06-23