Incidental Mutation 'R1829:Pkd1'
ID 207176
Institutional Source Beutler Lab
Gene Symbol Pkd1
Ensembl Gene ENSMUSG00000032855
Gene Name polycystin 1, transient receptor potential channel interacting
Synonyms polycystin-1, PC-1, PC1
MMRRC Submission 039856-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1829 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 24768808-24815482 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 24784558 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 368 (H368L)
Ref Sequence ENSEMBL: ENSMUSP00000049296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035565] [ENSMUST00000228745]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000035565
AA Change: H368L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000049296
Gene: ENSMUSG00000032855
AA Change: H368L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
LRRNT 32 71 1.61e-8 SMART
LRR_TYP 90 113 2.47e-5 SMART
LRRCT 125 177 3.84e-12 SMART
WSC 177 271 6.93e-34 SMART
PKD 272 355 2.72e-15 SMART
CLECT 406 530 5.72e-20 SMART
low complexity region 545 558 N/A INTRINSIC
low complexity region 763 788 N/A INTRINSIC
PKD 930 1008 1.06e-8 SMART
PKD 1015 1119 2.26e-12 SMART
PKD 1122 1205 2.03e-14 SMART
PKD 1208 1288 1.14e-17 SMART
PKD 1290 1373 2.35e-10 SMART
PKD 1374 1459 7.63e-10 SMART
PKD 1464 1541 1.95e-16 SMART
PKD 1544 1625 1.05e-16 SMART
PKD 1631 1714 1.93e-1 SMART
PKD 1716 1798 2.21e-15 SMART
PKD 1799 1882 5.7e-9 SMART
PKD 1884 1964 1.56e-6 SMART
PKD 1968 2056 3.1e-10 SMART
PKD 2057 2140 1.74e-13 SMART
Pfam:REJ 2167 2610 1e-108 PFAM
low complexity region 2697 2706 N/A INTRINSIC
GPS 3003 3052 1.33e-12 SMART
transmembrane domain 3065 3087 N/A INTRINSIC
LH2 3110 3224 3.5e-18 SMART
transmembrane domain 3275 3294 N/A INTRINSIC
transmembrane domain 3314 3336 N/A INTRINSIC
low complexity region 3357 3378 N/A INTRINSIC
low complexity region 3479 3492 N/A INTRINSIC
transmembrane domain 3547 3569 N/A INTRINSIC
low complexity region 3573 3591 N/A INTRINSIC
low complexity region 3626 3639 N/A INTRINSIC
low complexity region 3661 3676 N/A INTRINSIC
Pfam:PKD_channel 3701 4103 7.1e-125 PFAM
low complexity region 4153 4172 N/A INTRINSIC
low complexity region 4238 4256 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000228745
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded glycoprotein contains a large N-terminal extracellular region, multiple transmembrane domains and a cytoplasmic C-tail. It is an integral membrane protein that functions as a regulator of calcium permeable cation channels and intracellular calcium homoeostasis. It is also involved in cell-cell/matrix interactions and may modulate G-protein-coupled signal-transduction pathways. It plays a role in renal tubular development, and mutations in this gene cause autosomal dominant polycystic kidney disease type 1 (ADPKD1). ADPKD1 is characterized by the growth of fluid-filled cysts that replace normal renal tissue and result in end-stage renal failure. Splice variants encoding different isoforms have been noted for this gene. Also, six pseudogenes, closely linked in a known duplicated region on chromosome 16p, have been described. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutant embryos begin to die after embryonic day (E) 14.5. They develop edema by E13.5, pancreatic cysts by E15.5 and kidney cysts by E16.5. Heterozygous adults develop cysts of the kidneys (~20-30%) and the liver (~10%) late in life. [provided by MGI curators]
Allele List at MGI

All alleles(32) : Targeted(28) Gene trapped(3) Chemically induced(1)

Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars1 A T 8: 111,769,338 (GRCm39) D287V probably damaging Het
Abca12 A G 1: 71,334,188 (GRCm39) C1105R probably benign Het
Abca8b T A 11: 109,833,167 (GRCm39) N1178Y probably damaging Het
Abhd12 A G 2: 150,685,318 (GRCm39) L189P probably damaging Het
Acap2 G T 16: 30,929,752 (GRCm39) N435K probably damaging Het
Adam6b G T 12: 113,453,545 (GRCm39) G121C probably damaging Het
Adgrb1 C A 15: 74,452,435 (GRCm39) C200* probably null Het
Agbl5 T C 5: 31,060,408 (GRCm39) S730P possibly damaging Het
Ahsg G A 16: 22,711,078 (GRCm39) probably benign Het
Aldh9a1 A T 1: 167,189,423 (GRCm39) K390N probably benign Het
Alpk2 T A 18: 65,427,165 (GRCm39) H1857L possibly damaging Het
Apip T A 2: 102,919,007 (GRCm39) N102K probably benign Het
Asxl2 T C 12: 3,507,125 (GRCm39) S106P probably damaging Het
Atp2b2 G T 6: 113,750,329 (GRCm39) R677S probably damaging Het
Barhl1 A C 2: 28,799,857 (GRCm39) M256R probably damaging Het
Cacnb2 A T 2: 14,990,775 (GRCm39) Q619L possibly damaging Het
Ccdc137 C T 11: 120,349,038 (GRCm39) P23L probably benign Het
Cdh11 A T 8: 103,361,273 (GRCm39) N688K possibly damaging Het
Cdh18 C T 15: 23,173,938 (GRCm39) P51S probably damaging Het
Cdin1 G T 2: 115,473,173 (GRCm39) R101L possibly damaging Het
Cfhr1 A T 1: 139,481,338 (GRCm39) Y181N probably damaging Het
Chmp3 A G 6: 71,537,923 (GRCm39) D50G probably benign Het
Crem T C 18: 3,295,037 (GRCm39) probably null Het
Cyb561a3 G A 19: 10,559,757 (GRCm39) W27* probably null Het
Cyp2d12 C A 15: 82,442,257 (GRCm39) N297K possibly damaging Het
Dclk2 C T 3: 86,712,946 (GRCm39) R503Q possibly damaging Het
Dnah12 T A 14: 26,522,032 (GRCm39) N1948K probably damaging Het
Dnah12 T C 14: 26,494,980 (GRCm39) L1346P probably damaging Het
Dsp T G 13: 38,377,171 (GRCm39) L1652R probably damaging Het
Dstyk G A 1: 132,377,333 (GRCm39) S66N probably benign Het
Ehhadh T C 16: 21,580,928 (GRCm39) E688G probably damaging Het
Emsy G T 7: 98,251,937 (GRCm39) H688N possibly damaging Het
Emsy T A 7: 98,251,936 (GRCm39) H688L possibly damaging Het
Endod1 A G 9: 14,268,222 (GRCm39) L421P probably damaging Het
Fam222b C T 11: 78,045,861 (GRCm39) P346L probably damaging Het
Fam3c G A 6: 22,309,436 (GRCm39) R182W probably damaging Het
Gck T C 11: 5,860,984 (GRCm39) D29G probably damaging Het
Gm10320 C A 13: 98,626,207 (GRCm39) R59L probably damaging Het
Gm21798 C T 15: 64,689,675 (GRCm39) probably benign Het
Gm9376 A G 14: 118,504,957 (GRCm39) T130A possibly damaging Het
Gpr153 T A 4: 152,366,849 (GRCm39) I334N possibly damaging Het
Greb1l T C 18: 10,509,314 (GRCm39) L542P probably damaging Het
H2-T15 G T 17: 36,368,896 (GRCm39) F61L probably damaging Het
Hacl1 T C 14: 31,362,491 (GRCm39) E52G probably benign Het
Ice2 A G 9: 69,314,635 (GRCm39) Y128C probably damaging Het
Ikzf2 T A 1: 69,581,446 (GRCm39) I121L probably benign Het
Ipcef1 C T 10: 6,869,900 (GRCm39) A167T probably benign Het
Jakmip2 T A 18: 43,715,145 (GRCm39) D127V possibly damaging Het
Jph4 T C 14: 55,352,368 (GRCm39) T122A probably damaging Het
Kcns2 A G 15: 34,838,949 (GRCm39) E104G probably damaging Het
Lars2 A C 9: 123,260,982 (GRCm39) R384S probably benign Het
Lsmem1 T A 12: 40,235,407 (GRCm39) H3L possibly damaging Het
Lsmem1 G T 12: 40,235,408 (GRCm39) H3N possibly damaging Het
Ly6g2 T G 15: 75,088,605 (GRCm39) probably null Het
Mfhas1 A C 8: 36,057,222 (GRCm39) S566R probably benign Het
Mfhas1 C G 8: 36,057,402 (GRCm39) R626G probably benign Het
Mgam A G 6: 40,643,826 (GRCm39) T585A probably damaging Het
Mmp25 T C 17: 23,858,997 (GRCm39) K185E probably benign Het
Mtch1 T C 17: 29,557,750 (GRCm39) I243V probably damaging Het
Mtcp1 A T X: 74,455,271 (GRCm39) Y25* probably null Het
Mybl2 A G 2: 162,901,503 (GRCm39) T35A probably benign Het
Myh11 T C 16: 14,041,744 (GRCm39) E736G probably damaging Het
Myh2 T C 11: 67,067,385 (GRCm39) I224T probably damaging Het
Mymx T C 17: 45,912,759 (GRCm39) probably benign Het
Nek10 A G 14: 14,863,454 (GRCm38) probably null Het
Nsd1 A T 13: 55,394,182 (GRCm39) K697N probably damaging Het
Nynrin A G 14: 56,110,404 (GRCm39) D1837G possibly damaging Het
Or14j4 G A 17: 37,921,168 (GRCm39) T158I probably benign Het
Or2ag2b A G 7: 106,418,214 (GRCm39) H308R probably benign Het
Or52s1 A T 7: 102,861,093 (GRCm39) T9S probably benign Het
Or5p81 T A 7: 108,266,851 (GRCm39) I76N probably benign Het
Or6k4 T A 1: 173,964,760 (GRCm39) I150N probably benign Het
Pgap6 T C 17: 26,341,194 (GRCm39) Y766H probably damaging Het
Phf19 T C 2: 34,801,781 (GRCm39) T10A probably benign Het
Plscr2 A G 9: 92,172,808 (GRCm39) R156G probably damaging Het
Ppp1r42 G A 1: 10,070,311 (GRCm39) R61C probably benign Het
Pptc7 T G 5: 122,451,679 (GRCm39) V45G probably damaging Het
Prlhr G A 19: 60,455,867 (GRCm39) T233I probably damaging Het
Prr23a4 T A 9: 98,785,446 (GRCm39) I37N possibly damaging Het
Reps1 C T 10: 17,983,462 (GRCm39) T435I probably damaging Het
Ret T A 6: 118,130,912 (GRCm39) T1084S probably damaging Het
Rgl2 T A 17: 34,152,595 (GRCm39) M402K probably benign Het
Rp2 A G X: 20,243,154 (GRCm39) K43R probably benign Het
Rundc3b A T 5: 8,629,117 (GRCm39) W95R probably damaging Het
Samd9l T C 6: 3,375,107 (GRCm39) D718G possibly damaging Het
Scnn1b G A 7: 121,502,068 (GRCm39) R242H probably benign Het
Smad4 G T 18: 73,774,965 (GRCm39) Q445K probably benign Het
Smchd1 G T 17: 71,677,332 (GRCm39) P1486T probably damaging Het
Snx25 G T 8: 46,488,669 (GRCm39) N895K possibly damaging Het
Sox2 A G 3: 34,704,890 (GRCm39) D109G probably damaging Het
Stfa2 A T 16: 36,225,564 (GRCm39) N38K probably damaging Het
Stfa2 C A 16: 36,225,573 (GRCm39) E35D possibly damaging Het
Stfa3 A G 16: 36,271,023 (GRCm39) L87P probably damaging Het
Strbp T C 2: 37,530,921 (GRCm39) D111G possibly damaging Het
Supt20 C A 3: 54,635,079 (GRCm39) probably benign Het
Svep1 A G 4: 58,096,310 (GRCm39) Y1437H possibly damaging Het
Tbx4 T A 11: 85,802,746 (GRCm39) probably null Het
Tmem117 A T 15: 94,992,432 (GRCm39) N364I probably damaging Het
Trat1 T C 16: 48,581,742 (GRCm39) E45G probably damaging Het
Trpc2 G A 7: 101,733,326 (GRCm39) D92N probably damaging Het
Trpm1 G A 7: 63,876,530 (GRCm39) D528N probably damaging Het
Ttll9 A G 2: 152,842,156 (GRCm39) S337G possibly damaging Het
Utrn A T 10: 12,351,018 (GRCm39) I355N probably damaging Het
Vangl1 A G 3: 102,070,782 (GRCm39) S385P probably benign Het
Vmn1r209 A G 13: 22,990,409 (GRCm39) S94P possibly damaging Het
Vmn2r28 T A 7: 5,496,810 (GRCm39) Q14L probably benign Het
Vps45 A G 3: 95,954,557 (GRCm39) probably null Het
Wdr48 T C 9: 119,733,396 (GRCm39) V81A probably benign Het
Xpnpep2 A G X: 47,214,230 (GRCm39) N476S probably benign Het
Zbtb41 A T 1: 139,374,660 (GRCm39) K707* probably null Het
Zfp442 A C 2: 150,250,983 (GRCm39) C306W probably damaging Het
Zfp811 T C 17: 33,017,116 (GRCm39) N307S possibly damaging Het
Zfp976 A G 7: 42,265,735 (GRCm39) W17R probably damaging Het
Zyg11b T C 4: 108,123,290 (GRCm39) T226A possibly damaging Het
Other mutations in Pkd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Pkd1 APN 17 24,799,069 (GRCm39) missense probably damaging 1.00
IGL00503:Pkd1 APN 17 24,784,401 (GRCm39) missense probably benign
IGL00549:Pkd1 APN 17 24,791,735 (GRCm39) missense probably benign
IGL00573:Pkd1 APN 17 24,813,504 (GRCm39) nonsense probably null
IGL00924:Pkd1 APN 17 24,790,601 (GRCm39) nonsense probably null
IGL01319:Pkd1 APN 17 24,806,893 (GRCm39) unclassified probably benign
IGL01326:Pkd1 APN 17 24,795,148 (GRCm39) nonsense probably null
IGL01457:Pkd1 APN 17 24,813,795 (GRCm39) splice site probably null
IGL01541:Pkd1 APN 17 24,805,272 (GRCm39) missense probably damaging 1.00
IGL01575:Pkd1 APN 17 24,792,102 (GRCm39) missense probably damaging 1.00
IGL01606:Pkd1 APN 17 24,795,497 (GRCm39) missense probably damaging 0.97
IGL01642:Pkd1 APN 17 24,800,266 (GRCm39) missense probably damaging 1.00
IGL01888:Pkd1 APN 17 24,804,789 (GRCm39) missense possibly damaging 0.91
IGL01940:Pkd1 APN 17 24,798,720 (GRCm39) missense possibly damaging 0.63
IGL01958:Pkd1 APN 17 24,799,298 (GRCm39) missense probably damaging 1.00
IGL02005:Pkd1 APN 17 24,804,978 (GRCm39) missense possibly damaging 0.67
IGL02121:Pkd1 APN 17 24,794,901 (GRCm39) missense probably benign 0.03
IGL02148:Pkd1 APN 17 24,798,810 (GRCm39) missense probably damaging 1.00
IGL02409:Pkd1 APN 17 24,792,597 (GRCm39) missense probably benign 0.01
IGL02442:Pkd1 APN 17 24,784,200 (GRCm39) missense probably benign 0.41
IGL02498:Pkd1 APN 17 24,804,753 (GRCm39) missense possibly damaging 0.91
IGL02501:Pkd1 APN 17 24,788,673 (GRCm39) missense probably benign 0.01
IGL02551:Pkd1 APN 17 24,792,789 (GRCm39) missense probably damaging 1.00
IGL02635:Pkd1 APN 17 24,791,785 (GRCm39) missense probably damaging 1.00
IGL02673:Pkd1 APN 17 24,790,257 (GRCm39) missense probably benign 0.40
IGL02808:Pkd1 APN 17 24,812,478 (GRCm39) missense probably damaging 1.00
IGL02816:Pkd1 APN 17 24,813,489 (GRCm39) missense probably benign 0.00
IGL02863:Pkd1 APN 17 24,788,726 (GRCm39) missense possibly damaging 0.56
IGL02927:Pkd1 APN 17 24,794,163 (GRCm39) missense probably damaging 1.00
IGL02961:Pkd1 APN 17 24,797,089 (GRCm39) missense possibly damaging 0.81
IGL03003:Pkd1 APN 17 24,812,577 (GRCm39) critical splice donor site probably null
IGL03066:Pkd1 APN 17 24,805,208 (GRCm39) missense probably damaging 1.00
IGL03182:Pkd1 APN 17 24,792,792 (GRCm39) missense probably damaging 0.98
IGL03384:Pkd1 APN 17 24,784,871 (GRCm39) missense probably benign 0.00
IGL03404:Pkd1 APN 17 24,783,380 (GRCm39) missense probably damaging 0.97
PIT1430001:Pkd1 UTSW 17 24,788,485 (GRCm39) missense probably damaging 0.99
PIT4494001:Pkd1 UTSW 17 24,796,775 (GRCm39) missense probably damaging 1.00
PIT4677001:Pkd1 UTSW 17 24,793,003 (GRCm39) missense possibly damaging 0.94
R0017:Pkd1 UTSW 17 24,797,513 (GRCm39) critical splice donor site probably null
R0017:Pkd1 UTSW 17 24,797,513 (GRCm39) critical splice donor site probably null
R0022:Pkd1 UTSW 17 24,813,793 (GRCm39) missense probably damaging 0.98
R0022:Pkd1 UTSW 17 24,813,793 (GRCm39) missense probably damaging 0.98
R0058:Pkd1 UTSW 17 24,783,677 (GRCm39) missense probably benign 0.06
R0058:Pkd1 UTSW 17 24,783,677 (GRCm39) missense probably benign 0.06
R0085:Pkd1 UTSW 17 24,805,197 (GRCm39) missense probably damaging 0.98
R0094:Pkd1 UTSW 17 24,800,250 (GRCm39) missense possibly damaging 0.80
R0094:Pkd1 UTSW 17 24,800,250 (GRCm39) missense possibly damaging 0.80
R0135:Pkd1 UTSW 17 24,784,045 (GRCm39) missense possibly damaging 0.85
R0304:Pkd1 UTSW 17 24,804,920 (GRCm39) missense probably damaging 1.00
R0427:Pkd1 UTSW 17 24,812,476 (GRCm39) missense probably damaging 0.98
R0502:Pkd1 UTSW 17 24,793,766 (GRCm39) missense probably damaging 0.99
R0518:Pkd1 UTSW 17 24,814,193 (GRCm39) missense probably benign 0.01
R0521:Pkd1 UTSW 17 24,814,193 (GRCm39) missense probably benign 0.01
R0544:Pkd1 UTSW 17 24,804,657 (GRCm39) missense probably damaging 1.00
R0546:Pkd1 UTSW 17 24,799,112 (GRCm39) missense probably benign 0.44
R0626:Pkd1 UTSW 17 24,794,549 (GRCm39) missense probably damaging 0.96
R0648:Pkd1 UTSW 17 24,813,911 (GRCm39) missense probably damaging 1.00
R1138:Pkd1 UTSW 17 24,805,006 (GRCm39) missense probably damaging 1.00
R1302:Pkd1 UTSW 17 24,787,210 (GRCm39) missense probably benign 0.00
R1306:Pkd1 UTSW 17 24,792,146 (GRCm39) missense probably damaging 0.97
R1349:Pkd1 UTSW 17 24,794,240 (GRCm39) missense probably damaging 1.00
R1372:Pkd1 UTSW 17 24,794,240 (GRCm39) missense probably damaging 1.00
R1437:Pkd1 UTSW 17 24,814,106 (GRCm39) missense probably damaging 1.00
R1515:Pkd1 UTSW 17 24,813,827 (GRCm39) missense probably benign 0.01
R1605:Pkd1 UTSW 17 24,796,500 (GRCm39) missense possibly damaging 0.95
R1622:Pkd1 UTSW 17 24,800,614 (GRCm39) missense probably benign
R1623:Pkd1 UTSW 17 24,797,243 (GRCm39) missense probably damaging 0.99
R1726:Pkd1 UTSW 17 24,783,150 (GRCm39) missense probably damaging 0.96
R1756:Pkd1 UTSW 17 24,813,459 (GRCm39) missense probably damaging 1.00
R1780:Pkd1 UTSW 17 24,800,543 (GRCm39) missense probably benign
R1785:Pkd1 UTSW 17 24,810,073 (GRCm39) missense probably benign 0.00
R1869:Pkd1 UTSW 17 24,813,905 (GRCm39) missense probably damaging 1.00
R1920:Pkd1 UTSW 17 24,814,131 (GRCm39) missense probably damaging 0.99
R1922:Pkd1 UTSW 17 24,814,131 (GRCm39) missense probably damaging 0.99
R1987:Pkd1 UTSW 17 24,795,566 (GRCm39) splice site probably null
R1988:Pkd1 UTSW 17 24,795,566 (GRCm39) splice site probably null
R1998:Pkd1 UTSW 17 24,791,988 (GRCm39) missense probably damaging 1.00
R2007:Pkd1 UTSW 17 24,798,759 (GRCm39) missense probably damaging 1.00
R2019:Pkd1 UTSW 17 24,787,658 (GRCm39) nonsense probably null
R2054:Pkd1 UTSW 17 24,793,770 (GRCm39) missense probably benign 0.00
R2061:Pkd1 UTSW 17 24,788,888 (GRCm39) missense possibly damaging 0.89
R2196:Pkd1 UTSW 17 24,799,046 (GRCm39) missense possibly damaging 0.60
R2203:Pkd1 UTSW 17 24,799,863 (GRCm39) missense probably benign 0.01
R2301:Pkd1 UTSW 17 24,793,586 (GRCm39) missense probably benign
R2655:Pkd1 UTSW 17 24,795,464 (GRCm39) missense probably damaging 0.99
R2860:Pkd1 UTSW 17 24,784,420 (GRCm39) missense probably benign 0.43
R2861:Pkd1 UTSW 17 24,784,420 (GRCm39) missense probably benign 0.43
R3000:Pkd1 UTSW 17 24,813,460 (GRCm39) missense probably damaging 1.00
R3150:Pkd1 UTSW 17 24,798,765 (GRCm39) missense probably benign 0.00
R3747:Pkd1 UTSW 17 24,810,435 (GRCm39) missense possibly damaging 0.67
R3812:Pkd1 UTSW 17 24,784,615 (GRCm39) missense probably benign 0.00
R3859:Pkd1 UTSW 17 24,797,066 (GRCm39) splice site probably benign
R3893:Pkd1 UTSW 17 24,791,084 (GRCm39) critical splice donor site probably null
R3947:Pkd1 UTSW 17 24,797,011 (GRCm39) splice site probably benign
R3949:Pkd1 UTSW 17 24,797,011 (GRCm39) splice site probably benign
R4176:Pkd1 UTSW 17 24,806,971 (GRCm39) missense probably benign 0.17
R4199:Pkd1 UTSW 17 24,789,004 (GRCm39) missense probably benign 0.41
R4225:Pkd1 UTSW 17 24,812,497 (GRCm39) missense possibly damaging 0.50
R4439:Pkd1 UTSW 17 24,804,666 (GRCm39) missense probably damaging 1.00
R4476:Pkd1 UTSW 17 24,795,500 (GRCm39) missense probably damaging 1.00
R4716:Pkd1 UTSW 17 24,795,107 (GRCm39) missense probably damaging 1.00
R4801:Pkd1 UTSW 17 24,797,070 (GRCm39) missense probably damaging 1.00
R4802:Pkd1 UTSW 17 24,797,070 (GRCm39) missense probably damaging 1.00
R4817:Pkd1 UTSW 17 24,784,348 (GRCm39) splice site probably null
R4903:Pkd1 UTSW 17 24,790,976 (GRCm39) missense probably benign 0.30
R4910:Pkd1 UTSW 17 24,791,661 (GRCm39) missense probably damaging 1.00
R4964:Pkd1 UTSW 17 24,805,042 (GRCm39) critical splice donor site probably null
R4966:Pkd1 UTSW 17 24,805,042 (GRCm39) critical splice donor site probably null
R5040:Pkd1 UTSW 17 24,790,234 (GRCm39) missense probably benign 0.02
R5042:Pkd1 UTSW 17 24,788,861 (GRCm39) missense probably benign 0.00
R5088:Pkd1 UTSW 17 24,809,812 (GRCm39) missense possibly damaging 0.94
R5121:Pkd1 UTSW 17 24,792,437 (GRCm39) missense probably benign
R5296:Pkd1 UTSW 17 24,795,048 (GRCm39) missense probably damaging 1.00
R5338:Pkd1 UTSW 17 24,813,510 (GRCm39) missense probably benign
R5356:Pkd1 UTSW 17 24,812,551 (GRCm39) missense probably damaging 0.97
R5357:Pkd1 UTSW 17 24,784,764 (GRCm39) missense probably damaging 1.00
R5363:Pkd1 UTSW 17 24,784,047 (GRCm39) missense probably benign
R5383:Pkd1 UTSW 17 24,793,349 (GRCm39) missense probably benign
R5622:Pkd1 UTSW 17 24,793,014 (GRCm39) missense possibly damaging 0.67
R5651:Pkd1 UTSW 17 24,810,361 (GRCm39) missense possibly damaging 0.88
R5664:Pkd1 UTSW 17 24,788,345 (GRCm39) missense probably damaging 0.99
R5723:Pkd1 UTSW 17 24,784,497 (GRCm39) missense probably benign 0.01
R5797:Pkd1 UTSW 17 24,811,615 (GRCm39) missense possibly damaging 0.55
R5838:Pkd1 UTSW 17 24,799,186 (GRCm39) missense possibly damaging 0.75
R5866:Pkd1 UTSW 17 24,799,935 (GRCm39) missense probably damaging 0.99
R5873:Pkd1 UTSW 17 24,788,804 (GRCm39) missense probably benign
R5906:Pkd1 UTSW 17 24,791,894 (GRCm39) missense probably benign 0.16
R6047:Pkd1 UTSW 17 24,814,059 (GRCm39) missense probably damaging 1.00
R6076:Pkd1 UTSW 17 24,800,004 (GRCm39) missense probably benign 0.14
R6151:Pkd1 UTSW 17 24,794,580 (GRCm39) missense probably benign 0.00
R6252:Pkd1 UTSW 17 24,800,200 (GRCm39) missense probably damaging 0.98
R6341:Pkd1 UTSW 17 24,799,201 (GRCm39) missense probably damaging 1.00
R6540:Pkd1 UTSW 17 24,794,951 (GRCm39) missense probably damaging 1.00
R6732:Pkd1 UTSW 17 24,788,387 (GRCm39) missense probably damaging 1.00
R6836:Pkd1 UTSW 17 24,800,233 (GRCm39) missense probably damaging 1.00
R6856:Pkd1 UTSW 17 24,792,467 (GRCm39) missense probably benign 0.05
R6865:Pkd1 UTSW 17 24,795,461 (GRCm39) missense probably benign 0.43
R6999:Pkd1 UTSW 17 24,797,475 (GRCm39) missense possibly damaging 0.62
R7077:Pkd1 UTSW 17 24,810,093 (GRCm39) missense probably damaging 1.00
R7123:Pkd1 UTSW 17 24,813,742 (GRCm39) missense possibly damaging 0.89
R7134:Pkd1 UTSW 17 24,813,086 (GRCm39) missense probably damaging 0.99
R7210:Pkd1 UTSW 17 24,794,840 (GRCm39) missense probably damaging 0.98
R7323:Pkd1 UTSW 17 24,794,025 (GRCm39) missense probably benign 0.01
R7380:Pkd1 UTSW 17 24,800,616 (GRCm39) missense probably damaging 1.00
R7407:Pkd1 UTSW 17 24,813,568 (GRCm39) missense probably damaging 1.00
R7410:Pkd1 UTSW 17 24,794,855 (GRCm39) missense probably damaging 1.00
R7492:Pkd1 UTSW 17 24,788,715 (GRCm39) missense probably benign 0.04
R7517:Pkd1 UTSW 17 24,799,393 (GRCm39) missense probably damaging 1.00
R7543:Pkd1 UTSW 17 24,814,227 (GRCm39) missense probably damaging 0.99
R7560:Pkd1 UTSW 17 24,792,605 (GRCm39) missense probably benign 0.33
R7615:Pkd1 UTSW 17 24,812,476 (GRCm39) missense probably damaging 0.98
R7714:Pkd1 UTSW 17 24,769,250 (GRCm39) missense unknown
R7718:Pkd1 UTSW 17 24,805,474 (GRCm39) missense probably benign 0.15
R7731:Pkd1 UTSW 17 24,792,872 (GRCm39) missense probably damaging 1.00
R7849:Pkd1 UTSW 17 24,805,174 (GRCm39) missense probably damaging 0.98
R7859:Pkd1 UTSW 17 24,790,254 (GRCm39) missense probably damaging 1.00
R7866:Pkd1 UTSW 17 24,809,881 (GRCm39) missense probably benign 0.26
R7915:Pkd1 UTSW 17 24,811,630 (GRCm39) nonsense probably null
R7991:Pkd1 UTSW 17 24,791,595 (GRCm39) missense possibly damaging 0.95
R8050:Pkd1 UTSW 17 24,784,617 (GRCm39) missense probably benign 0.26
R8086:Pkd1 UTSW 17 24,800,188 (GRCm39) missense probably damaging 1.00
R8312:Pkd1 UTSW 17 24,786,102 (GRCm39) missense probably benign 0.02
R8385:Pkd1 UTSW 17 24,794,702 (GRCm39) missense possibly damaging 0.67
R8393:Pkd1 UTSW 17 24,791,621 (GRCm39) missense probably damaging 0.99
R8552:Pkd1 UTSW 17 24,810,443 (GRCm39) missense probably damaging 1.00
R8753:Pkd1 UTSW 17 24,793,176 (GRCm39) missense probably damaging 1.00
R8822:Pkd1 UTSW 17 24,784,615 (GRCm39) missense probably benign 0.00
R8855:Pkd1 UTSW 17 24,792,051 (GRCm39) missense probably damaging 1.00
R8866:Pkd1 UTSW 17 24,792,051 (GRCm39) missense probably damaging 1.00
R8867:Pkd1 UTSW 17 24,792,807 (GRCm39) missense probably damaging 1.00
R8960:Pkd1 UTSW 17 24,795,176 (GRCm39) missense probably damaging 1.00
R8966:Pkd1 UTSW 17 24,794,751 (GRCm39) missense possibly damaging 0.69
R9004:Pkd1 UTSW 17 24,799,421 (GRCm39) missense probably benign
R9015:Pkd1 UTSW 17 24,784,636 (GRCm39) nonsense probably null
R9069:Pkd1 UTSW 17 24,791,988 (GRCm39) missense probably damaging 1.00
R9092:Pkd1 UTSW 17 24,788,347 (GRCm39) missense possibly damaging 0.93
R9135:Pkd1 UTSW 17 24,790,976 (GRCm39) missense
R9307:Pkd1 UTSW 17 24,769,451 (GRCm39) missense possibly damaging 0.90
R9312:Pkd1 UTSW 17 24,797,364 (GRCm39) missense probably damaging 1.00
R9313:Pkd1 UTSW 17 24,813,932 (GRCm39) missense probably damaging 1.00
R9380:Pkd1 UTSW 17 24,769,262 (GRCm39) missense unknown
R9383:Pkd1 UTSW 17 24,794,900 (GRCm39) missense probably damaging 1.00
R9531:Pkd1 UTSW 17 24,792,114 (GRCm39) missense probably damaging 0.99
R9617:Pkd1 UTSW 17 24,800,341 (GRCm39) missense probably damaging 1.00
R9691:Pkd1 UTSW 17 24,796,812 (GRCm39) missense possibly damaging 0.77
R9792:Pkd1 UTSW 17 24,800,172 (GRCm39) missense probably benign
R9793:Pkd1 UTSW 17 24,800,172 (GRCm39) missense probably benign
X0024:Pkd1 UTSW 17 24,810,366 (GRCm39) missense possibly damaging 0.68
X0061:Pkd1 UTSW 17 24,813,905 (GRCm39) missense probably damaging 1.00
X0065:Pkd1 UTSW 17 24,805,138 (GRCm39) missense probably benign 0.19
Z1088:Pkd1 UTSW 17 24,784,579 (GRCm39) missense probably benign 0.44
Z1177:Pkd1 UTSW 17 24,794,465 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCAGCAGACTTCCATATTACTTC -3'
(R):5'- ATCAGGGTATGCATGAGGCTG -3'

Sequencing Primer
(F):5'- TCAACACGCTGGAACTTTGG -3'
(R):5'- ATGCATGAGGCTGGGTGC -3'
Posted On 2014-06-23