Mutagenetix > Incidental Mutation

Incidental Mutation 'R1829:Greb1l'

207187

Institutional Source

Beutler Lab

Gene Symbol

Greb1l

Ensembl Gene

ENSMUSG00000042942

Gene Name

growth regulation by estrogen in breast cancer-like

Synonyms

AK220484, mKIAA4095

MMRRC Submission

039856-MU

Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1829 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

10325177-10562934 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 10509314 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 542 (L542P)

Ref Sequence

ENSEMBL: ENSMUSP00000049003 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172532] [ENSMUST00000172680]

AlphaFold

B9EJV3

Predicted Effect

probably damaging
Transcript: ENSMUST00000048977
AA Change: L542P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: L542P

Domain	Start	End	E-Value	Type
Pfam:GREB1	1	1172	N/A	PFAM
Pfam:GREB1	1154	1913	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000172532

SMART Domains

Protein: ENSMUSP00000134090
Gene: ENSMUSG00000042942

Domain	Start	End	E-Value	Type
low complexity region	83	100	N/A	INTRINSIC
low complexity region	282	301	N/A	INTRINSIC
low complexity region	606	617	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000172680

SMART Domains

Protein: ENSMUSP00000134314
Gene: ENSMUSG00000042942

Domain	Start	End	E-Value	Type
low complexity region	116	129	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174553

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 91.7%

Validation Efficiency

Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock

Total: 114 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
7420426K07Rik	T	A	9: 98,903,393	I37N	possibly damaging	Het
Aars	A	T	8: 111,042,706	D287V	probably damaging	Het
Abca12	A	G	1: 71,295,029	C1105R	probably benign	Het
Abca8b	T	A	11: 109,942,341	N1178Y	probably damaging	Het
Abhd12	A	G	2: 150,843,398	L189P	probably damaging	Het
Acap2	G	T	16: 31,110,934	N435K	probably damaging	Het
Adam6b	G	T	12: 113,489,925	G121C	probably damaging	Het
Adgrb1	C	A	15: 74,580,586	C200*	probably null	Het
Agbl5	T	C	5: 30,903,064	S730P	possibly damaging	Het
Ahsg	G	A	16: 22,892,328		probably benign	Het
Aldh9a1	A	T	1: 167,361,854	K390N	probably benign	Het
Alpk2	T	A	18: 65,294,094	H1857L	possibly damaging	Het
Apip	T	A	2: 103,088,662	N102K	probably benign	Het
Asxl2	T	C	12: 3,457,125	S106P	probably damaging	Het
Atp2b2	G	T	6: 113,773,368	R677S	probably damaging	Het
Barhl1	A	C	2: 28,909,845	M256R	probably damaging	Het
BC025446	T	G	15: 75,216,756		probably null	Het
BC052040	G	T	2: 115,642,692	R101L	possibly damaging	Het
Cacnb2	A	T	2: 14,985,964	Q619L	possibly damaging	Het
Ccdc137	C	T	11: 120,458,212	P23L	probably benign	Het
Cdh11	A	T	8: 102,634,641	N688K	possibly damaging	Het
Cdh18	C	T	15: 23,173,852	P51S	probably damaging	Het
Cfhr1	A	T	1: 139,553,600	Y181N	probably damaging	Het
Chmp3	A	G	6: 71,560,939	D50G	probably benign	Het
Crem	T	C	18: 3,295,037		probably null	Het
Cyb561a3	G	A	19: 10,582,393	W27*	probably null	Het
Cyp2d12	C	A	15: 82,558,056	N297K	possibly damaging	Het
Dclk2	C	T	3: 86,805,639	R503Q	possibly damaging	Het
Dnah12	T	C	14: 26,773,023	L1346P	probably damaging	Het
Dnah12	T	A	14: 26,800,075	N1948K	probably damaging	Het
Dsp	T	G	13: 38,193,195	L1652R	probably damaging	Het
Dstyk	G	A	1: 132,449,595	S66N	probably benign	Het
Ehhadh	T	C	16: 21,762,178	E688G	probably damaging	Het
Emsy	T	A	7: 98,602,729	H688L	possibly damaging	Het
Emsy	G	T	7: 98,602,730	H688N	possibly damaging	Het
Endod1	A	G	9: 14,356,926	L421P	probably damaging	Het
Fam222b	C	T	11: 78,155,035	P346L	probably damaging	Het
Fam3c	G	A	6: 22,309,437	R182W	probably damaging	Het
Gck	T	C	11: 5,910,984	D29G	probably damaging	Het
Gm10320	C	A	13: 98,489,699	R59L	probably damaging	Het
Gm11127	G	T	17: 36,058,004	F61L	probably damaging	Het
Gm21798	C	T	15: 64,817,826		probably benign	Het
Gm9376	A	G	14: 118,267,545	T130A	possibly damaging	Het
Gpr153	T	A	4: 152,282,392	I334N	possibly damaging	Het
Hacl1	T	C	14: 31,640,534	E52G	probably benign	Het
Ice2	A	G	9: 69,407,353	Y128C	probably damaging	Het
Ikzf2	T	A	1: 69,542,287	I121L	probably benign	Het
Ipcef1	C	T	10: 6,919,900	A167T	probably benign	Het
Jakmip2	T	A	18: 43,582,080	D127V	possibly damaging	Het
Jph4	T	C	14: 55,114,911	T122A	probably damaging	Het
Kcns2	A	G	15: 34,838,803	E104G	probably damaging	Het
Lars2	A	C	9: 123,431,917	R384S	probably benign	Het
Lsmem1	T	A	12: 40,185,408	H3L	possibly damaging	Het
Lsmem1	G	T	12: 40,185,409	H3N	possibly damaging	Het
Mfhas1	A	C	8: 35,590,068	S566R	probably benign	Het
Mfhas1	C	G	8: 35,590,248	R626G	probably benign	Het
Mgam	A	G	6: 40,666,892	T585A	probably damaging	Het
Mmp25	T	C	17: 23,640,023	K185E	probably benign	Het
Mtch1	T	C	17: 29,338,776	I243V	probably damaging	Het
Mtcp1	A	T	X: 75,411,665	Y25*	probably null	Het
Mybl2	A	G	2: 163,059,583	T35A	probably benign	Het
Myh11	T	C	16: 14,223,880	E736G	probably damaging	Het
Myh2	T	C	11: 67,176,559	I224T	probably damaging	Het
Mymx	T	C	17: 45,601,833		probably benign	Het
Nek10	A	G	14: 14,863,454		probably null	Het
Nsd1	A	T	13: 55,246,369	K697N	probably damaging	Het
Nynrin	A	G	14: 55,872,947	D1837G	possibly damaging	Het
Olfr115	G	A	17: 37,610,277	T158I	probably benign	Het
Olfr424	T	A	1: 174,137,194	I150N	probably benign	Het
Olfr510	T	A	7: 108,667,644	I76N	probably benign	Het
Olfr593	A	T	7: 103,211,886	T9S	probably benign	Het
Olfr701	A	G	7: 106,819,007	H308R	probably benign	Het
Phf19	T	C	2: 34,911,769	T10A	probably benign	Het
Pkd1	A	T	17: 24,565,584	H368L	probably benign	Het
Plscr2	A	G	9: 92,290,755	R156G	probably damaging	Het
Ppp1r42	G	A	1: 10,000,086	R61C	probably benign	Het
Pptc7	T	G	5: 122,313,616	V45G	probably damaging	Het
Prlhr	G	A	19: 60,467,429	T233I	probably damaging	Het
Reps1	C	T	10: 18,107,714	T435I	probably damaging	Het
Ret	T	A	6: 118,153,951	T1084S	probably damaging	Het
Rgl2	T	A	17: 33,933,621	M402K	probably benign	Het
Rp2	A	G	X: 20,376,915	K43R	probably benign	Het
Rundc3b	A	T	5: 8,579,117	W95R	probably damaging	Het
Samd9l	T	C	6: 3,375,107	D718G	possibly damaging	Het
Scnn1b	G	A	7: 121,902,845	R242H	probably benign	Het
Smad4	G	T	18: 73,641,894	Q445K	probably benign	Het
Smchd1	G	T	17: 71,370,337	P1486T	probably damaging	Het
Snx25	G	T	8: 46,035,632	N895K	possibly damaging	Het
Sox2	A	G	3: 34,650,741	D109G	probably damaging	Het
Stfa2	A	T	16: 36,405,202	N38K	probably damaging	Het
Stfa2	C	A	16: 36,405,211	E35D	possibly damaging	Het
Stfa3	A	G	16: 36,450,661	L87P	probably damaging	Het
Strbp	T	C	2: 37,640,909	D111G	possibly damaging	Het
Supt20	C	A	3: 54,727,658		probably benign	Het
Svep1	A	G	4: 58,096,310	Y1437H	possibly damaging	Het
Tbx4	T	A	11: 85,911,920		probably null	Het
Tmem117	A	T	15: 95,094,551	N364I	probably damaging	Het
Tmem8	T	C	17: 26,122,220	Y766H	probably damaging	Het
Trat1	T	C	16: 48,761,379	E45G	probably damaging	Het
Trpc2	G	A	7: 102,084,119	D92N	probably damaging	Het
Trpm1	G	A	7: 64,226,782	D528N	probably damaging	Het
Ttll9	A	G	2: 153,000,236	S337G	possibly damaging	Het
Utrn	A	T	10: 12,475,274	I355N	probably damaging	Het
Vangl1	A	G	3: 102,163,466	S385P	probably benign	Het
Vmn1r209	A	G	13: 22,806,239	S94P	possibly damaging	Het
Vmn2r28	T	A	7: 5,493,811	Q14L	probably benign	Het
Vps45	A	G	3: 96,047,245		probably null	Het
Wdr48	T	C	9: 119,904,330	V81A	probably benign	Het
Xpnpep2	A	G	X: 48,125,353	N476S	probably benign	Het
Zbtb41	A	T	1: 139,446,922	K707*	probably null	Het
Zfp442	A	C	2: 150,409,063	C306W	probably damaging	Het
Zfp811	T	C	17: 32,798,142	N307S	possibly damaging	Het
Zfp976	A	G	7: 42,616,311	W17R	probably damaging	Het
Zyg11b	T	C	4: 108,266,093	T226A	possibly damaging	Het

Other mutations in Greb1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Greb1l	APN	18	10555962	missense	possibly damaging	0.90
IGL01554:Greb1l	APN	18	10522144	missense	probably benign	0.01
IGL01563:Greb1l	APN	18	10469399	missense	probably damaging	0.99
IGL01944:Greb1l	APN	18	10557280	missense	possibly damaging	0.91
IGL02110:Greb1l	APN	18	10515271	missense	probably damaging	1.00
IGL02249:Greb1l	APN	18	10532961	missense	probably damaging	1.00
IGL02318:Greb1l	APN	18	10469388	missense	possibly damaging	0.91
IGL02340:Greb1l	APN	18	10515200	missense	probably damaging	0.99
IGL02516:Greb1l	APN	18	10537064	missense	probably benign	0.31
IGL02566:Greb1l	APN	18	10503299	missense	probably damaging	0.99
IGL02583:Greb1l	APN	18	10542362	missense	probably damaging	1.00
IGL02838:Greb1l	APN	18	10560430	missense	probably damaging	1.00
A4554:Greb1l	UTSW	18	10532862	missense	possibly damaging	0.58
PIT4453001:Greb1l	UTSW	18	10533031	missense	probably damaging	0.98
PIT4453001:Greb1l	UTSW	18	10533032	missense	probably benign	0.08
R0099:Greb1l	UTSW	18	10509158	missense	probably damaging	1.00
R0226:Greb1l	UTSW	18	10522076	intron	probably benign
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0239:Greb1l	UTSW	18	10458567	splice site	probably benign
R0316:Greb1l	UTSW	18	10547420	missense	probably damaging	1.00
R0369:Greb1l	UTSW	18	10469375	missense	possibly damaging	0.80
R0394:Greb1l	UTSW	18	10523374	missense	probably damaging	0.99
R0478:Greb1l	UTSW	18	10509281	missense	probably damaging	1.00
R0555:Greb1l	UTSW	18	10458781	splice site	probably benign
R0671:Greb1l	UTSW	18	10474303	missense	probably damaging	1.00
R1282:Greb1l	UTSW	18	10547289	missense	probably benign	0.13
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1607:Greb1l	UTSW	18	10529703	missense	possibly damaging	0.85
R1666:Greb1l	UTSW	18	10501080	critical splice donor site	probably null
R1666:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R1720:Greb1l	UTSW	18	10553848	missense	probably benign	0.19
R1808:Greb1l	UTSW	18	10542143	missense	probably benign
R1897:Greb1l	UTSW	18	10498992	missense	probably benign	0.00
R1967:Greb1l	UTSW	18	10501049	missense	possibly damaging	0.91
R2025:Greb1l	UTSW	18	10515221	missense	possibly damaging	0.71
R2086:Greb1l	UTSW	18	10523281	missense	probably damaging	1.00
R2125:Greb1l	UTSW	18	10511422	missense	probably damaging	0.98
R2139:Greb1l	UTSW	18	10555011	missense	probably damaging	1.00
R2255:Greb1l	UTSW	18	10554857	missense	probably damaging	1.00
R2256:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2257:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2880:Greb1l	UTSW	18	10547288	missense	possibly damaging	0.93
R3623:Greb1l	UTSW	18	10542380	missense	probably damaging	0.99
R3778:Greb1l	UTSW	18	10469444	missense	possibly damaging	0.60
R3975:Greb1l	UTSW	18	10522247	missense	possibly damaging	0.71
R4038:Greb1l	UTSW	18	10515209	missense	possibly damaging	0.93
R4062:Greb1l	UTSW	18	10522150	missense	probably damaging	0.99
R4134:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R4342:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R4409:Greb1l	UTSW	18	10503182	missense	possibly damaging	0.70
R4600:Greb1l	UTSW	18	10553705	missense	probably damaging	1.00
R4618:Greb1l	UTSW	18	10498965	missense	probably benign	0.00
R4683:Greb1l	UTSW	18	10529563	splice site	probably null
R4686:Greb1l	UTSW	18	10522112	missense	probably damaging	0.98
R4707:Greb1l	UTSW	18	10532922	missense	probably benign	0.02
R4780:Greb1l	UTSW	18	10541792	missense	probably benign	0.00
R4819:Greb1l	UTSW	18	10458358	missense	probably damaging	1.00
R4925:Greb1l	UTSW	18	10547447	missense	possibly damaging	0.79
R4960:Greb1l	UTSW	18	10547306	missense	probably damaging	0.99
R5150:Greb1l	UTSW	18	10555950	frame shift	probably null
R5154:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5269:Greb1l	UTSW	18	10511409	missense	probably benign
R5290:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5310:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5328:Greb1l	UTSW	18	10553720	missense	probably damaging	1.00
R5337:Greb1l	UTSW	18	10509143	missense	probably damaging	1.00
R5393:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5402:Greb1l	UTSW	18	10537169	missense	probably benign	0.26
R5718:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5719:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5720:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5721:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5902:Greb1l	UTSW	18	10538302	missense	probably benign	0.00
R5993:Greb1l	UTSW	18	10544455	missense	probably benign	0.10
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6045:Greb1l	UTSW	18	10547068	missense	probably damaging	1.00
R6063:Greb1l	UTSW	18	10557340	missense	probably damaging	1.00
R6297:Greb1l	UTSW	18	10469494	missense	probably damaging	1.00
R6405:Greb1l	UTSW	18	10501076	missense	probably benign	0.30
R6552:Greb1l	UTSW	18	10541814	missense	probably benign	0.00
R6572:Greb1l	UTSW	18	10522131	missense	probably benign	0.07
R6575:Greb1l	UTSW	18	10547347	missense	possibly damaging	0.88
R6922:Greb1l	UTSW	18	10547482	missense	possibly damaging	0.88
R6957:Greb1l	UTSW	18	10558786	missense	probably benign	0.23
R6962:Greb1l	UTSW	18	10547327	missense	probably damaging	1.00
R7012:Greb1l	UTSW	18	10529707	critical splice donor site	probably null
R7179:Greb1l	UTSW	18	10544576	missense	probably benign	0.00
R7251:Greb1l	UTSW	18	10515319	missense	probably damaging	1.00
R7275:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R7301:Greb1l	UTSW	18	10544970	missense	probably damaging	1.00
R7307:Greb1l	UTSW	18	10538142	missense	probably damaging	0.99
R7455:Greb1l	UTSW	18	10554915	missense	probably damaging	1.00
R7832:Greb1l	UTSW	18	10542056	missense	probably benign	0.38
R7934:Greb1l	UTSW	18	10474371	nonsense	probably null
R8137:Greb1l	UTSW	18	10474357	missense	possibly damaging	0.77
R8138:Greb1l	UTSW	18	10533060	missense	probably benign	0.13
R8208:Greb1l	UTSW	18	10510703	missense	probably damaging	1.00
R8227:Greb1l	UTSW	18	10515371	missense	probably damaging	1.00
R8312:Greb1l	UTSW	18	10511587	intron	probably benign
R8331:Greb1l	UTSW	18	10458706	missense	possibly damaging	0.96
R8364:Greb1l	UTSW	18	10529687	missense	possibly damaging	0.85
R8389:Greb1l	UTSW	18	10529613	missense	probably benign	0.00
R8695:Greb1l	UTSW	18	10544450	missense	probably benign	0.01
R8795:Greb1l	UTSW	18	10553739	missense	probably damaging	0.98
R8836:Greb1l	UTSW	18	10509257	missense	probably benign	0.30
R8862:Greb1l	UTSW	18	10555042	missense	possibly damaging	0.90
R8872:Greb1l	UTSW	18	10529684	missense	probably benign	0.18
R8874:Greb1l	UTSW	18	10544896	missense	probably benign	0.01
R8886:Greb1l	UTSW	18	10553843	missense	probably benign	0.21
R8921:Greb1l	UTSW	18	10541825	missense	probably benign	0.01
R8997:Greb1l	UTSW	18	10510747	missense	probably damaging	1.00
R9015:Greb1l	UTSW	18	10541675	missense	probably benign	0.00
R9018:Greb1l	UTSW	18	10542004	missense	possibly damaging	0.76
R9074:Greb1l	UTSW	18	10532797	missense	probably damaging	1.00
R9074:Greb1l	UTSW	18	10558795	missense	probably damaging	1.00
R9117:Greb1l	UTSW	18	10542422	missense	probably benign	0.31
R9189:Greb1l	UTSW	18	10499983	missense	probably benign
R9332:Greb1l	UTSW	18	10532796	missense	possibly damaging	0.92
R9367:Greb1l	UTSW	18	10522130	missense	probably benign	0.00
R9497:Greb1l	UTSW	18	10458600	missense	probably benign	0.00
R9796:Greb1l	UTSW	18	10538233	missense	possibly damaging	0.69
Z1176:Greb1l	UTSW	18	10515305	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGATCATGCTGACTGCTATGC -3'
(R):5'- AGAGCGTAATTACATGGATGCTG -3'

Sequencing Primer
(F):5'- CAGGAGTTTTCTGTGAGAGAGC -3'
(R):5'- CATGGATGCTGGAAATATCAATTGC -3'

Posted On

2014-06-23