Mutagenetix > Incidental Mutation

Incidental Mutation 'R1829:Smad4'

207191

Institutional Source

Beutler Lab

Gene Symbol

Smad4

Ensembl Gene

ENSMUSG00000024515

Gene Name

SMAD family member 4

Synonyms

Dpc4, Smad 4, Madh4, DPC4, D18Wsu70e

MMRRC Submission

039856-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1829 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

73639009-73703780 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 73641894 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 445 (Q445K)

Ref Sequence

ENSEMBL: ENSMUSP00000110589 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025393] [ENSMUST00000114939]

AlphaFold

P97471

Predicted Effect

probably benign
Transcript: ENSMUST00000025393
AA Change: Q445K

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000025393
Gene: ENSMUSG00000024515
AA Change: Q445K

Domain	Start	End	E-Value	Type
DWA	31	140	5.77e-65	SMART
low complexity region	286	299	N/A	INTRINSIC
DWB	320	529	1.41e-123	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000114939
AA Change: Q445K

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000110589
Gene: ENSMUSG00000024515
AA Change: Q445K

Domain	Start	End	E-Value	Type
DWA	31	140	5.77e-65	SMART
low complexity region	286	299	N/A	INTRINSIC
DWB	320	529	1.41e-123	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131339

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142672

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147315

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 91.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Smad family of signal transduction proteins. Smad proteins are phosphorylated and activated by transmembrane serine-threonine receptor kinases in response to TGF-beta signaling. The product of this gene forms homomeric complexes and heteromeric complexes with other activated Smad proteins, which then accumulate in the nucleus and regulate the transcription of target genes. This protein binds to DNA and recognizes an 8-bp palindromic sequence (GTCTAGAC) called the Smad-binding element (SBE). The Smad proteins are subject to complex regulation by post-translational modifications. Mutations or deletions in this gene have been shown to result in pancreatic cancer, juvenile polyposis syndrome, and hereditary hemorrhagic telangiectasia syndrome. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired formation of extraembryonic membrane and endoderm and die prior to gastrulation. Heterozygotes develop polyposis of the glandular stomach and duodenum. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 114 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
7420426K07Rik	T	A	9: 98,903,393	I37N	possibly damaging	Het
Aars	A	T	8: 111,042,706	D287V	probably damaging	Het
Abca12	A	G	1: 71,295,029	C1105R	probably benign	Het
Abca8b	T	A	11: 109,942,341	N1178Y	probably damaging	Het
Abhd12	A	G	2: 150,843,398	L189P	probably damaging	Het
Acap2	G	T	16: 31,110,934	N435K	probably damaging	Het
Adam6b	G	T	12: 113,489,925	G121C	probably damaging	Het
Adgrb1	C	A	15: 74,580,586	C200*	probably null	Het
Agbl5	T	C	5: 30,903,064	S730P	possibly damaging	Het
Ahsg	G	A	16: 22,892,328		probably benign	Het
Aldh9a1	A	T	1: 167,361,854	K390N	probably benign	Het
Alpk2	T	A	18: 65,294,094	H1857L	possibly damaging	Het
Apip	T	A	2: 103,088,662	N102K	probably benign	Het
Asxl2	T	C	12: 3,457,125	S106P	probably damaging	Het
Atp2b2	G	T	6: 113,773,368	R677S	probably damaging	Het
Barhl1	A	C	2: 28,909,845	M256R	probably damaging	Het
BC025446	T	G	15: 75,216,756		probably null	Het
BC052040	G	T	2: 115,642,692	R101L	possibly damaging	Het
Cacnb2	A	T	2: 14,985,964	Q619L	possibly damaging	Het
Ccdc137	C	T	11: 120,458,212	P23L	probably benign	Het
Cdh11	A	T	8: 102,634,641	N688K	possibly damaging	Het
Cdh18	C	T	15: 23,173,852	P51S	probably damaging	Het
Cfhr1	A	T	1: 139,553,600	Y181N	probably damaging	Het
Chmp3	A	G	6: 71,560,939	D50G	probably benign	Het
Crem	T	C	18: 3,295,037		probably null	Het
Cyb561a3	G	A	19: 10,582,393	W27*	probably null	Het
Cyp2d12	C	A	15: 82,558,056	N297K	possibly damaging	Het
Dclk2	C	T	3: 86,805,639	R503Q	possibly damaging	Het
Dnah12	T	C	14: 26,773,023	L1346P	probably damaging	Het
Dnah12	T	A	14: 26,800,075	N1948K	probably damaging	Het
Dsp	T	G	13: 38,193,195	L1652R	probably damaging	Het
Dstyk	G	A	1: 132,449,595	S66N	probably benign	Het
Ehhadh	T	C	16: 21,762,178	E688G	probably damaging	Het
Emsy	T	A	7: 98,602,729	H688L	possibly damaging	Het
Emsy	G	T	7: 98,602,730	H688N	possibly damaging	Het
Endod1	A	G	9: 14,356,926	L421P	probably damaging	Het
Fam222b	C	T	11: 78,155,035	P346L	probably damaging	Het
Fam3c	G	A	6: 22,309,437	R182W	probably damaging	Het
Gck	T	C	11: 5,910,984	D29G	probably damaging	Het
Gm10320	C	A	13: 98,489,699	R59L	probably damaging	Het
Gm11127	G	T	17: 36,058,004	F61L	probably damaging	Het
Gm21798	C	T	15: 64,817,826		probably benign	Het
Gm9376	A	G	14: 118,267,545	T130A	possibly damaging	Het
Gpr153	T	A	4: 152,282,392	I334N	possibly damaging	Het
Greb1l	T	C	18: 10,509,314	L542P	probably damaging	Het
Hacl1	T	C	14: 31,640,534	E52G	probably benign	Het
Ice2	A	G	9: 69,407,353	Y128C	probably damaging	Het
Ikzf2	T	A	1: 69,542,287	I121L	probably benign	Het
Ipcef1	C	T	10: 6,919,900	A167T	probably benign	Het
Jakmip2	T	A	18: 43,582,080	D127V	possibly damaging	Het
Jph4	T	C	14: 55,114,911	T122A	probably damaging	Het
Kcns2	A	G	15: 34,838,803	E104G	probably damaging	Het
Lars2	A	C	9: 123,431,917	R384S	probably benign	Het
Lsmem1	T	A	12: 40,185,408	H3L	possibly damaging	Het
Lsmem1	G	T	12: 40,185,409	H3N	possibly damaging	Het
Mfhas1	A	C	8: 35,590,068	S566R	probably benign	Het
Mfhas1	C	G	8: 35,590,248	R626G	probably benign	Het
Mgam	A	G	6: 40,666,892	T585A	probably damaging	Het
Mmp25	T	C	17: 23,640,023	K185E	probably benign	Het
Mtch1	T	C	17: 29,338,776	I243V	probably damaging	Het
Mtcp1	A	T	X: 75,411,665	Y25*	probably null	Het
Mybl2	A	G	2: 163,059,583	T35A	probably benign	Het
Myh11	T	C	16: 14,223,880	E736G	probably damaging	Het
Myh2	T	C	11: 67,176,559	I224T	probably damaging	Het
Mymx	T	C	17: 45,601,833		probably benign	Het
Nek10	A	G	14: 14,863,454		probably null	Het
Nsd1	A	T	13: 55,246,369	K697N	probably damaging	Het
Nynrin	A	G	14: 55,872,947	D1837G	possibly damaging	Het
Olfr115	G	A	17: 37,610,277	T158I	probably benign	Het
Olfr424	T	A	1: 174,137,194	I150N	probably benign	Het
Olfr510	T	A	7: 108,667,644	I76N	probably benign	Het
Olfr593	A	T	7: 103,211,886	T9S	probably benign	Het
Olfr701	A	G	7: 106,819,007	H308R	probably benign	Het
Phf19	T	C	2: 34,911,769	T10A	probably benign	Het
Pkd1	A	T	17: 24,565,584	H368L	probably benign	Het
Plscr2	A	G	9: 92,290,755	R156G	probably damaging	Het
Ppp1r42	G	A	1: 10,000,086	R61C	probably benign	Het
Pptc7	T	G	5: 122,313,616	V45G	probably damaging	Het
Prlhr	G	A	19: 60,467,429	T233I	probably damaging	Het
Reps1	C	T	10: 18,107,714	T435I	probably damaging	Het
Ret	T	A	6: 118,153,951	T1084S	probably damaging	Het
Rgl2	T	A	17: 33,933,621	M402K	probably benign	Het
Rp2	A	G	X: 20,376,915	K43R	probably benign	Het
Rundc3b	A	T	5: 8,579,117	W95R	probably damaging	Het
Samd9l	T	C	6: 3,375,107	D718G	possibly damaging	Het
Scnn1b	G	A	7: 121,902,845	R242H	probably benign	Het
Smchd1	G	T	17: 71,370,337	P1486T	probably damaging	Het
Snx25	G	T	8: 46,035,632	N895K	possibly damaging	Het
Sox2	A	G	3: 34,650,741	D109G	probably damaging	Het
Stfa2	A	T	16: 36,405,202	N38K	probably damaging	Het
Stfa2	C	A	16: 36,405,211	E35D	possibly damaging	Het
Stfa3	A	G	16: 36,450,661	L87P	probably damaging	Het
Strbp	T	C	2: 37,640,909	D111G	possibly damaging	Het
Supt20	C	A	3: 54,727,658		probably benign	Het
Svep1	A	G	4: 58,096,310	Y1437H	possibly damaging	Het
Tbx4	T	A	11: 85,911,920		probably null	Het
Tmem117	A	T	15: 95,094,551	N364I	probably damaging	Het
Tmem8	T	C	17: 26,122,220	Y766H	probably damaging	Het
Trat1	T	C	16: 48,761,379	E45G	probably damaging	Het
Trpc2	G	A	7: 102,084,119	D92N	probably damaging	Het
Trpm1	G	A	7: 64,226,782	D528N	probably damaging	Het
Ttll9	A	G	2: 153,000,236	S337G	possibly damaging	Het
Utrn	A	T	10: 12,475,274	I355N	probably damaging	Het
Vangl1	A	G	3: 102,163,466	S385P	probably benign	Het
Vmn1r209	A	G	13: 22,806,239	S94P	possibly damaging	Het
Vmn2r28	T	A	7: 5,493,811	Q14L	probably benign	Het
Vps45	A	G	3: 96,047,245		probably null	Het
Wdr48	T	C	9: 119,904,330	V81A	probably benign	Het
Xpnpep2	A	G	X: 48,125,353	N476S	probably benign	Het
Zbtb41	A	T	1: 139,446,922	K707*	probably null	Het
Zfp442	A	C	2: 150,409,063	C306W	probably damaging	Het
Zfp811	T	C	17: 32,798,142	N307S	possibly damaging	Het
Zfp976	A	G	7: 42,616,311	W17R	probably damaging	Het
Zyg11b	T	C	4: 108,266,093	T226A	possibly damaging	Het

Other mutations in Smad4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01012:Smad4	APN	18	73675809	missense	probably damaging	1.00
IGL01647:Smad4	APN	18	73640473	splice site	probably benign
IGL02055:Smad4	APN	18	73641928	splice site	probably benign
IGL02101:Smad4	APN	18	73658652	missense	probably benign	0.02
IGL02306:Smad4	APN	18	73662869	critical splice acceptor site	probably null
R0391:Smad4	UTSW	18	73658649	missense	probably benign
R1118:Smad4	UTSW	18	73640262	missense	probably benign	0.41
R1163:Smad4	UTSW	18	73648907	missense	probably damaging	0.99
R1211:Smad4	UTSW	18	73649911	critical splice acceptor site	probably null
R1616:Smad4	UTSW	18	73640262	missense	probably benign	0.41
R1742:Smad4	UTSW	18	73675897	missense	probably damaging	1.00
R2045:Smad4	UTSW	18	73649806	nonsense	probably null
R2126:Smad4	UTSW	18	73662744	missense	probably benign	0.02
R3013:Smad4	UTSW	18	73648904	missense	probably damaging	1.00
R3973:Smad4	UTSW	18	73677736	missense	possibly damaging	0.49
R3974:Smad4	UTSW	18	73677736	missense	possibly damaging	0.49
R3975:Smad4	UTSW	18	73677736	missense	possibly damaging	0.49
R4879:Smad4	UTSW	18	73641903	missense	probably damaging	1.00
R5101:Smad4	UTSW	18	73675860	missense	probably benign	0.41
R5597:Smad4	UTSW	18	73662827	missense	probably benign
R5984:Smad4	UTSW	18	73677911	start codon destroyed	probably benign	0.29
R6450:Smad4	UTSW	18	73677746	missense	possibly damaging	0.73
R7450:Smad4	UTSW	18	73677853	missense	probably damaging	1.00
R7524:Smad4	UTSW	18	73675871	missense	probably damaging	1.00
R8001:Smad4	UTSW	18	73641810	missense	probably damaging	0.99
R8526:Smad4	UTSW	18	73657259	splice site	probably null
R9110:Smad4	UTSW	18	73649870	missense	probably damaging	1.00
R9151:Smad4	UTSW	18	73649735	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAACCGAGGTTACAAGTCACC -3'
(R):5'- ACGGATCTGTTCCAAACACTG -3'

Sequencing Primer
(F):5'- AGGTTACAAGTCACCACTGTACTCTG -3'
(R):5'- CCTGGGACTGCAGTTACATAGTTAC -3'

Posted On

2014-06-23