Incidental Mutation 'R1829:Rp2'
ID 207194
Institutional Source Beutler Lab
Gene Symbol Rp2
Ensembl Gene ENSMUSG00000060090
Gene Name retinitis pigmentosa 2 homolog
Synonyms Rp2h
MMRRC Submission 039856-MU
Accession Numbers
Essential gene? Not available question?
Stock # R1829 (G1)
Quality Score 222
Status Not validated
Chromosome X
Chromosomal Location 20364481-20405653 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 20376915 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 43 (K43R)
Ref Sequence ENSEMBL: ENSMUSP00000138352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033372] [ENSMUST00000115387] [ENSMUST00000115391] [ENSMUST00000133619] [ENSMUST00000134349]
AlphaFold Q9EPK2
Predicted Effect probably benign
Transcript: ENSMUST00000033372
AA Change: K43R

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000033372
Gene: ENSMUSG00000060090
AA Change: K43R

DomainStartEndE-ValueType
CARP 64 101 8.74e-12 SMART
CARP 102 136 1.41e-6 SMART
SCOP:d1hlwa_ 247 312 8e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115387
AA Change: K6R

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000111045
Gene: ENSMUSG00000060090
AA Change: K6R

DomainStartEndE-ValueType
CARP 27 64 8.74e-12 SMART
CARP 65 99 1.41e-6 SMART
Pfam:NDK 194 296 1.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115391
AA Change: K43R

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000111049
Gene: ENSMUSG00000060090
AA Change: K43R

DomainStartEndE-ValueType
CARP 64 101 8.74e-12 SMART
CARP 102 136 1.41e-6 SMART
Pfam:NDK 231 333 1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133619
AA Change: K43R

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000138724
Gene: ENSMUSG00000060090
AA Change: K43R

DomainStartEndE-ValueType
CARP 64 101 8.74e-12 SMART
CARP 102 136 1.41e-6 SMART
Pfam:NDK 231 320 1.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134349
AA Change: K43R

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000138352
Gene: ENSMUSG00000060090
AA Change: K43R

DomainStartEndE-ValueType
CARP 64 101 8.74e-12 SMART
CARP 102 136 1.41e-6 SMART
Pfam:NDK 231 337 8.7e-8 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The RP2 locus has been implicated as one cause of X-linked retinitis pigmentosa. The predicted gene product shows homology with human cofactor C, a protein involved in the ultimate step of beta-tubulin folding. Progressive retinal degeneration may therefore be due to the accumulation of incorrectly-folded photoreceptor or neuron-specific tubulin isoforms followed by progressive cell death [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
7420426K07Rik T A 9: 98,903,393 (GRCm38) I37N possibly damaging Het
Aars A T 8: 111,042,706 (GRCm38) D287V probably damaging Het
Abca12 A G 1: 71,295,029 (GRCm38) C1105R probably benign Het
Abca8b T A 11: 109,942,341 (GRCm38) N1178Y probably damaging Het
Abhd12 A G 2: 150,843,398 (GRCm38) L189P probably damaging Het
Acap2 G T 16: 31,110,934 (GRCm38) N435K probably damaging Het
Adam6b G T 12: 113,489,925 (GRCm38) G121C probably damaging Het
Adgrb1 C A 15: 74,580,586 (GRCm38) C200* probably null Het
Agbl5 T C 5: 30,903,064 (GRCm38) S730P possibly damaging Het
Ahsg G A 16: 22,892,328 (GRCm38) probably benign Het
Aldh9a1 A T 1: 167,361,854 (GRCm38) K390N probably benign Het
Alpk2 T A 18: 65,294,094 (GRCm38) H1857L possibly damaging Het
Apip T A 2: 103,088,662 (GRCm38) N102K probably benign Het
Asxl2 T C 12: 3,457,125 (GRCm38) S106P probably damaging Het
Atp2b2 G T 6: 113,773,368 (GRCm38) R677S probably damaging Het
Barhl1 A C 2: 28,909,845 (GRCm38) M256R probably damaging Het
BC025446 T G 15: 75,216,756 (GRCm38) probably null Het
BC052040 G T 2: 115,642,692 (GRCm38) R101L possibly damaging Het
Cacnb2 A T 2: 14,985,964 (GRCm38) Q619L possibly damaging Het
Ccdc137 C T 11: 120,458,212 (GRCm38) P23L probably benign Het
Cdh11 A T 8: 102,634,641 (GRCm38) N688K possibly damaging Het
Cdh18 C T 15: 23,173,852 (GRCm38) P51S probably damaging Het
Cfhr1 A T 1: 139,553,600 (GRCm38) Y181N probably damaging Het
Chmp3 A G 6: 71,560,939 (GRCm38) D50G probably benign Het
Crem T C 18: 3,295,037 (GRCm38) probably null Het
Cyb561a3 G A 19: 10,582,393 (GRCm38) W27* probably null Het
Cyp2d12 C A 15: 82,558,056 (GRCm38) N297K possibly damaging Het
Dclk2 C T 3: 86,805,639 (GRCm38) R503Q possibly damaging Het
Dnah12 T C 14: 26,773,023 (GRCm38) L1346P probably damaging Het
Dnah12 T A 14: 26,800,075 (GRCm38) N1948K probably damaging Het
Dsp T G 13: 38,193,195 (GRCm38) L1652R probably damaging Het
Dstyk G A 1: 132,449,595 (GRCm38) S66N probably benign Het
Ehhadh T C 16: 21,762,178 (GRCm38) E688G probably damaging Het
Emsy G T 7: 98,602,730 (GRCm38) H688N possibly damaging Het
Emsy T A 7: 98,602,729 (GRCm38) H688L possibly damaging Het
Endod1 A G 9: 14,356,926 (GRCm38) L421P probably damaging Het
Fam222b C T 11: 78,155,035 (GRCm38) P346L probably damaging Het
Fam3c G A 6: 22,309,437 (GRCm38) R182W probably damaging Het
Gck T C 11: 5,910,984 (GRCm38) D29G probably damaging Het
Gm10320 C A 13: 98,489,699 (GRCm38) R59L probably damaging Het
Gm11127 G T 17: 36,058,004 (GRCm38) F61L probably damaging Het
Gm21798 C T 15: 64,817,826 (GRCm38) probably benign Het
Gm9376 A G 14: 118,267,545 (GRCm38) T130A possibly damaging Het
Gpr153 T A 4: 152,282,392 (GRCm38) I334N possibly damaging Het
Greb1l T C 18: 10,509,314 (GRCm38) L542P probably damaging Het
Hacl1 T C 14: 31,640,534 (GRCm38) E52G probably benign Het
Ice2 A G 9: 69,407,353 (GRCm38) Y128C probably damaging Het
Ikzf2 T A 1: 69,542,287 (GRCm38) I121L probably benign Het
Ipcef1 C T 10: 6,919,900 (GRCm38) A167T probably benign Het
Jakmip2 T A 18: 43,582,080 (GRCm38) D127V possibly damaging Het
Jph4 T C 14: 55,114,911 (GRCm38) T122A probably damaging Het
Kcns2 A G 15: 34,838,803 (GRCm38) E104G probably damaging Het
Lars2 A C 9: 123,431,917 (GRCm38) R384S probably benign Het
Lsmem1 T A 12: 40,185,408 (GRCm38) H3L possibly damaging Het
Lsmem1 G T 12: 40,185,409 (GRCm38) H3N possibly damaging Het
Mfhas1 A C 8: 35,590,068 (GRCm38) S566R probably benign Het
Mfhas1 C G 8: 35,590,248 (GRCm38) R626G probably benign Het
Mgam A G 6: 40,666,892 (GRCm38) T585A probably damaging Het
Mmp25 T C 17: 23,640,023 (GRCm38) K185E probably benign Het
Mtch1 T C 17: 29,338,776 (GRCm38) I243V probably damaging Het
Mtcp1 A T X: 75,411,665 (GRCm38) Y25* probably null Het
Mybl2 A G 2: 163,059,583 (GRCm38) T35A probably benign Het
Myh11 T C 16: 14,223,880 (GRCm38) E736G probably damaging Het
Myh2 T C 11: 67,176,559 (GRCm38) I224T probably damaging Het
Mymx T C 17: 45,601,833 (GRCm38) probably benign Het
Nek10 A G 14: 14,863,454 (GRCm38) probably null Het
Nsd1 A T 13: 55,246,369 (GRCm38) K697N probably damaging Het
Nynrin A G 14: 55,872,947 (GRCm38) D1837G possibly damaging Het
Olfr115 G A 17: 37,610,277 (GRCm38) T158I probably benign Het
Olfr424 T A 1: 174,137,194 (GRCm38) I150N probably benign Het
Olfr510 T A 7: 108,667,644 (GRCm38) I76N probably benign Het
Olfr593 A T 7: 103,211,886 (GRCm38) T9S probably benign Het
Olfr701 A G 7: 106,819,007 (GRCm38) H308R probably benign Het
Phf19 T C 2: 34,911,769 (GRCm38) T10A probably benign Het
Pkd1 A T 17: 24,565,584 (GRCm38) H368L probably benign Het
Plscr2 A G 9: 92,290,755 (GRCm38) R156G probably damaging Het
Ppp1r42 G A 1: 10,000,086 (GRCm38) R61C probably benign Het
Pptc7 T G 5: 122,313,616 (GRCm38) V45G probably damaging Het
Prlhr G A 19: 60,467,429 (GRCm38) T233I probably damaging Het
Reps1 C T 10: 18,107,714 (GRCm38) T435I probably damaging Het
Ret T A 6: 118,153,951 (GRCm38) T1084S probably damaging Het
Rgl2 T A 17: 33,933,621 (GRCm38) M402K probably benign Het
Rundc3b A T 5: 8,579,117 (GRCm38) W95R probably damaging Het
Samd9l T C 6: 3,375,107 (GRCm38) D718G possibly damaging Het
Scnn1b G A 7: 121,902,845 (GRCm38) R242H probably benign Het
Smad4 G T 18: 73,641,894 (GRCm38) Q445K probably benign Het
Smchd1 G T 17: 71,370,337 (GRCm38) P1486T probably damaging Het
Snx25 G T 8: 46,035,632 (GRCm38) N895K possibly damaging Het
Sox2 A G 3: 34,650,741 (GRCm38) D109G probably damaging Het
Stfa2 A T 16: 36,405,202 (GRCm38) N38K probably damaging Het
Stfa2 C A 16: 36,405,211 (GRCm38) E35D possibly damaging Het
Stfa3 A G 16: 36,450,661 (GRCm38) L87P probably damaging Het
Strbp T C 2: 37,640,909 (GRCm38) D111G possibly damaging Het
Supt20 C A 3: 54,727,658 (GRCm38) probably benign Het
Svep1 A G 4: 58,096,310 (GRCm38) Y1437H possibly damaging Het
Tbx4 T A 11: 85,911,920 (GRCm38) probably null Het
Tmem117 A T 15: 95,094,551 (GRCm38) N364I probably damaging Het
Tmem8 T C 17: 26,122,220 (GRCm38) Y766H probably damaging Het
Trat1 T C 16: 48,761,379 (GRCm38) E45G probably damaging Het
Trpc2 G A 7: 102,084,119 (GRCm38) D92N probably damaging Het
Trpm1 G A 7: 64,226,782 (GRCm38) D528N probably damaging Het
Ttll9 A G 2: 153,000,236 (GRCm38) S337G possibly damaging Het
Utrn A T 10: 12,475,274 (GRCm38) I355N probably damaging Het
Vangl1 A G 3: 102,163,466 (GRCm38) S385P probably benign Het
Vmn1r209 A G 13: 22,806,239 (GRCm38) S94P possibly damaging Het
Vmn2r28 T A 7: 5,493,811 (GRCm38) Q14L probably benign Het
Vps45 A G 3: 96,047,245 (GRCm38) probably null Het
Wdr48 T C 9: 119,904,330 (GRCm38) V81A probably benign Het
Xpnpep2 A G X: 48,125,353 (GRCm38) N476S probably benign Het
Zbtb41 A T 1: 139,446,922 (GRCm38) K707* probably null Het
Zfp442 A C 2: 150,409,063 (GRCm38) C306W probably damaging Het
Zfp811 T C 17: 32,798,142 (GRCm38) N307S possibly damaging Het
Zfp976 A G 7: 42,616,311 (GRCm38) W17R probably damaging Het
Zyg11b T C 4: 108,266,093 (GRCm38) T226A possibly damaging Het
Other mutations in Rp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Rp2 APN X 20,377,169 (GRCm38) missense probably damaging 0.99
R9565:Rp2 UTSW X 20,377,542 (GRCm38) missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- TGAATGTGCCCTTGAACTTTG -3'
(R):5'- GGCAAGCCAATGTGCACTTG -3'

Sequencing Primer
(F):5'- AATGTGCCCTTGAACTTTGGTTTC -3'
(R):5'- GCACTTGCAATCTCTACAATTTCGG -3'
Posted On 2014-06-23