Incidental Mutation 'R1830:Slc39a10'
ID207197
Institutional Source Beutler Lab
Gene Symbol Slc39a10
Ensembl Gene ENSMUSG00000025986
Gene Namesolute carrier family 39 (zinc transporter), member 10
Synonyms2900042E17Rik
MMRRC Submission 039857-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.496) question?
Stock #R1830 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location46807544-46892852 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46836070 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 24 (H24R)
Ref Sequence ENSEMBL: ENSMUSP00000027131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027131] [ENSMUST00000185520] [ENSMUST00000186852]
Predicted Effect probably damaging
Transcript: ENSMUST00000027131
AA Change: H24R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027131
Gene: ENSMUSG00000025986
AA Change: H24R

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 122 134 N/A INTRINSIC
low complexity region 170 195 N/A INTRINSIC
low complexity region 224 244 N/A INTRINSIC
Pfam:Zip 406 607 9.9e-44 PFAM
Pfam:Zip 588 821 2.5e-69 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141226
Predicted Effect possibly damaging
Transcript: ENSMUST00000185520
AA Change: H34R

PolyPhen 2 Score 0.744 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000140570
Gene: ENSMUSG00000025986
AA Change: H34R

DomainStartEndE-ValueType
low complexity region 30 41 N/A INTRINSIC
low complexity region 132 144 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186852
AA Change: H24R

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140176
Gene: ENSMUSG00000025986
AA Change: H24R

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 122 134 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc is an essential cofactor for hundreds of enzymes. It is involved in protein, nucleic acid, carbohydrate, and lipid metabolism, as well as in the control of gene transcription, growth, development, and differentiation. SLC39A10 belongs to a subfamily of proteins that show structural characteristics of zinc transporters (Taylor and Nicholson, 2003 [PubMed 12659941]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice with conditional loss of function display defects in cellular proliferation and differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik T C 17: 25,946,717 D532G possibly damaging Het
Abca13 T C 11: 9,290,350 S738P probably benign Het
Abi3bp C A 16: 56,587,985 P261Q probably damaging Het
Adam19 A G 11: 46,127,278 N389S probably damaging Het
Adgrv1 A T 13: 81,489,077 V3415D possibly damaging Het
Ankrd33 A T 15: 101,119,551 I282F probably damaging Het
Arhgap39 C T 15: 76,735,183 V734M probably damaging Het
Arsg T C 11: 109,563,274 probably null Het
Atp8b4 C T 2: 126,403,381 G283R probably benign Het
B3galnt2 T G 13: 13,991,534 L338* probably null Het
C87414 A T 5: 93,637,686 I245K probably benign Het
Cdc14a A T 3: 116,422,647 Y1* probably null Het
Ceacam16 T C 7: 19,858,878 E35G possibly damaging Het
Cfap46 T A 7: 139,640,407 D1244V possibly damaging Het
Chordc1 T C 9: 18,311,978 Y245H probably damaging Het
Col6a6 C A 9: 105,702,270 V1919F probably damaging Het
Colgalt1 T C 8: 71,623,137 V476A probably damaging Het
Cped1 T C 6: 22,237,728 C948R probably damaging Het
Cyfip2 T C 11: 46,199,019 D1189G probably damaging Het
Cyp27b1 T C 10: 127,049,083 Y72H possibly damaging Het
Dagla A G 19: 10,271,014 M94T probably benign Het
Dip2a A G 10: 76,317,963 S178P probably damaging Het
Dlec1 T C 9: 119,138,790 V1220A probably benign Het
Dpysl2 T C 14: 66,868,391 probably benign Het
E2f6 T C 12: 16,818,883 V69A probably benign Het
Fat3 T C 9: 15,915,340 T4439A probably benign Het
Fn1 T C 1: 71,624,259 I1023M probably damaging Het
Gabrr2 G A 4: 33,077,481 V83M probably damaging Het
Gfral T C 9: 76,193,203 N318D probably benign Het
Gm5611 A T 9: 17,030,777 noncoding transcript Het
Gpat3 A T 5: 100,893,180 M369L probably benign Het
Grik5 T C 7: 25,046,301 D449G possibly damaging Het
Gucy2g T A 19: 55,222,930 T623S possibly damaging Het
H2-T22 T C 17: 36,041,542 T164A probably benign Het
Herc1 T A 9: 66,497,599 C4484S possibly damaging Het
Hira T C 16: 18,947,414 S659P probably damaging Het
Hoxa7 T C 6: 52,217,327 T27A possibly damaging Het
Hoxd1 T C 2: 74,763,522 S141P probably damaging Het
Kank1 C A 19: 25,411,032 Q690K probably benign Het
Kera A G 10: 97,609,147 K123E probably benign Het
Kif1bp T C 10: 62,559,327 Y512C probably damaging Het
Lepr A C 4: 101,735,677 Y163S probably damaging Het
Leprotl1 T C 8: 34,140,768 I29V probably benign Het
Lrriq1 T G 10: 103,161,759 T1332P probably benign Het
Mrps15 A G 4: 126,055,407 K223E probably damaging Het
Mrps7 T A 11: 115,606,985 N225K probably benign Het
Nav3 T A 10: 109,823,323 D811V probably damaging Het
Ndst3 T A 3: 123,548,938 R741S probably damaging Het
Nos3 T C 5: 24,370,133 Y356H probably damaging Het
Nxpe3 A G 16: 55,866,081 V188A probably damaging Het
Olfr1057 T C 2: 86,375,143 K90E possibly damaging Het
Olfr469 T A 7: 107,823,371 I33F probably benign Het
Olfr702 T C 7: 106,824,110 R139G probably benign Het
Pdia4 A T 6: 47,796,761 C551* probably null Het
Pex13 A G 11: 23,655,513 F239S probably damaging Het
Pigq A G 17: 25,935,006 M273T probably benign Het
Plppr2 C T 9: 21,947,751 P388L probably damaging Het
Polr3b C T 10: 84,692,922 Q737* probably null Het
Ppfibp1 T C 6: 147,022,259 probably null Het
Ppfibp2 C A 7: 107,637,297 D17E probably damaging Het
Ptpn13 A G 5: 103,543,459 D1064G probably benign Het
Qtrt2 A T 16: 43,871,655 S168T probably damaging Het
Rbp3 T C 14: 33,954,644 V183A probably benign Het
Shprh T C 10: 11,186,911 probably null Het
Slc7a13 A T 4: 19,819,046 H82L probably benign Het
Sptbn2 A G 19: 4,732,541 I502V probably benign Het
Syne2 C T 12: 76,109,862 R6811C probably damaging Het
Syt12 A G 19: 4,456,883 V78A probably benign Het
Tbck T A 3: 132,838,011 D874E probably benign Het
Tesc A T 5: 118,046,329 I25L probably damaging Het
Thoc5 T G 11: 4,914,608 D351E probably benign Het
Tor1aip1 A T 1: 156,007,562 M180K probably damaging Het
Trps1 T C 15: 50,661,136 S842G probably damaging Het
Unc79 A T 12: 103,134,478 T1858S probably damaging Het
Vmn1r193 T C 13: 22,219,391 T144A probably benign Het
Vwa8 T C 14: 79,081,136 F1046S probably benign Het
Wdr26 A T 1: 181,191,775 W346R probably damaging Het
Zfp740 T A 15: 102,207,901 V22E probably damaging Het
Zw10 C A 9: 49,069,741 S480R probably damaging Het
Other mutations in Slc39a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Slc39a10 APN 1 46819057 splice site probably benign
IGL01628:Slc39a10 APN 1 46835523 missense probably benign 0.23
IGL01939:Slc39a10 APN 1 46832735 missense probably benign 0.07
IGL02068:Slc39a10 APN 1 46819439 splice site probably benign
IGL02093:Slc39a10 APN 1 46835209 missense probably damaging 1.00
IGL02101:Slc39a10 APN 1 46818128 missense probably damaging 1.00
IGL02122:Slc39a10 APN 1 46818128 missense probably damaging 1.00
IGL02125:Slc39a10 APN 1 46818128 missense probably damaging 1.00
IGL02171:Slc39a10 APN 1 46818128 missense probably damaging 1.00
IGL02175:Slc39a10 APN 1 46818128 missense probably damaging 1.00
IGL02186:Slc39a10 APN 1 46818128 missense probably damaging 1.00
IGL02699:Slc39a10 APN 1 46818128 missense probably damaging 1.00
IGL02700:Slc39a10 APN 1 46818128 missense probably damaging 1.00
R0217:Slc39a10 UTSW 1 46835540 missense probably benign
R0704:Slc39a10 UTSW 1 46835861 missense possibly damaging 0.76
R0782:Slc39a10 UTSW 1 46835996 missense probably damaging 0.97
R1527:Slc39a10 UTSW 1 46819262 missense probably benign
R1566:Slc39a10 UTSW 1 46836085 missense possibly damaging 0.90
R1568:Slc39a10 UTSW 1 46826215 missense probably benign 0.00
R1664:Slc39a10 UTSW 1 46826109 missense probably damaging 1.00
R1954:Slc39a10 UTSW 1 46835174 missense possibly damaging 0.50
R2327:Slc39a10 UTSW 1 46835996 missense probably damaging 0.97
R3434:Slc39a10 UTSW 1 46835717 missense probably benign
R3761:Slc39a10 UTSW 1 46812125 missense possibly damaging 0.88
R4035:Slc39a10 UTSW 1 46812074 missense probably damaging 1.00
R4419:Slc39a10 UTSW 1 46810066 missense probably benign 0.42
R4675:Slc39a10 UTSW 1 46817984 intron probably benign
R4689:Slc39a10 UTSW 1 46836013 missense probably benign 0.00
R5310:Slc39a10 UTSW 1 46836125 missense probably damaging 1.00
R6073:Slc39a10 UTSW 1 46832612 missense possibly damaging 0.68
R6161:Slc39a10 UTSW 1 46827407 missense probably damaging 1.00
R6199:Slc39a10 UTSW 1 46835833 missense probably damaging 1.00
R6562:Slc39a10 UTSW 1 46835564 missense probably benign 0.02
R7087:Slc39a10 UTSW 1 46835720 missense probably damaging 1.00
R7222:Slc39a10 UTSW 1 46819292 missense possibly damaging 0.82
R7286:Slc39a10 UTSW 1 46810070 missense probably damaging 0.97
R7568:Slc39a10 UTSW 1 46835130 missense probably benign 0.14
R7891:Slc39a10 UTSW 1 46812168 missense probably damaging 1.00
R7918:Slc39a10 UTSW 1 46835752 missense possibly damaging 0.88
RF020:Slc39a10 UTSW 1 46810015 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTCCTCGTGATTAATCTCAACGAC -3'
(R):5'- ACTTGGTTAATGGATTGGCAATTGC -3'

Sequencing Primer
(F):5'- AACGACTTTGATCTCTCCAAGG -3'
(R):5'- ATGGATTGGCAATTGCAAAATAAG -3'
Posted On2014-06-23