Mutagenetix > Incidental Mutation

Incidental Mutation 'R1830:Lrriq1'

207250

Institutional Source

Beutler Lab

Gene Symbol

Lrriq1

Ensembl Gene

ENSMUSG00000019892

Gene Name

leucine-rich repeats and IQ motif containing 1

Synonyms

LOC380658, 4930503E15Rik, Gm1557

MMRRC Submission

039857-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.085) question?

Stock #

R1830 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

103046031-103236322 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 103161759 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Proline at position 1332 (T1332P)

Ref Sequence

ENSEMBL: ENSMUSP00000131419 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166240]

AlphaFold

Q0P5X1

Predicted Effect

probably benign
Transcript: ENSMUST00000166240
AA Change: T1332P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000131419
Gene: ENSMUSG00000019892
AA Change: T1332P

Domain	Start	End	E-Value	Type
coiled coil region	11	31	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
coiled coil region	183	286	N/A	INTRINSIC
IQ	290	312	9.78e1	SMART
coiled coil region	314	390	N/A	INTRINSIC
low complexity region	550	559	N/A	INTRINSIC
LRR	873	894	2.14e1	SMART
LRR	895	917	4.45e1	SMART
LRR	984	1005	2.03e2	SMART
LRR	1029	1052	3.65e0	SMART
low complexity region	1244	1258	N/A	INTRINSIC
IQ	1279	1301	5.61e1	SMART
IQ	1339	1361	6.7e-3	SMART
low complexity region	1369	1394	N/A	INTRINSIC
low complexity region	1502	1518	N/A	INTRINSIC
low complexity region	1528	1543	N/A	INTRINSIC

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.2%
20x: 92.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A930017K11Rik	T	C	17: 25,946,717	D532G	possibly damaging	Het
Abca13	T	C	11: 9,290,350	S738P	probably benign	Het
Abi3bp	C	A	16: 56,587,985	P261Q	probably damaging	Het
Adam19	A	G	11: 46,127,278	N389S	probably damaging	Het
Adgrv1	A	T	13: 81,489,077	V3415D	possibly damaging	Het
Ankrd33	A	T	15: 101,119,551	I282F	probably damaging	Het
Arhgap39	C	T	15: 76,735,183	V734M	probably damaging	Het
Arsg	T	C	11: 109,563,274		probably null	Het
Atp8b4	C	T	2: 126,403,381	G283R	probably benign	Het
B3galnt2	T	G	13: 13,991,534	L338*	probably null	Het
C87414	A	T	5: 93,637,686	I245K	probably benign	Het
Cdc14a	A	T	3: 116,422,647	Y1*	probably null	Het
Ceacam16	T	C	7: 19,858,878	E35G	possibly damaging	Het
Cfap46	T	A	7: 139,640,407	D1244V	possibly damaging	Het
Chordc1	T	C	9: 18,311,978	Y245H	probably damaging	Het
Col6a6	C	A	9: 105,702,270	V1919F	probably damaging	Het
Colgalt1	T	C	8: 71,623,137	V476A	probably damaging	Het
Cped1	T	C	6: 22,237,728	C948R	probably damaging	Het
Cyfip2	T	C	11: 46,199,019	D1189G	probably damaging	Het
Cyp27b1	T	C	10: 127,049,083	Y72H	possibly damaging	Het
Dagla	A	G	19: 10,271,014	M94T	probably benign	Het
Dip2a	A	G	10: 76,317,963	S178P	probably damaging	Het
Dlec1	T	C	9: 119,138,790	V1220A	probably benign	Het
Dpysl2	T	C	14: 66,868,391		probably benign	Het
E2f6	T	C	12: 16,818,883	V69A	probably benign	Het
Fat3	T	C	9: 15,915,340	T4439A	probably benign	Het
Fn1	T	C	1: 71,624,259	I1023M	probably damaging	Het
Gabrr2	G	A	4: 33,077,481	V83M	probably damaging	Het
Gfral	T	C	9: 76,193,203	N318D	probably benign	Het
Gm5611	A	T	9: 17,030,777		noncoding transcript	Het
Gpat3	A	T	5: 100,893,180	M369L	probably benign	Het
Grik5	T	C	7: 25,046,301	D449G	possibly damaging	Het
Gucy2g	T	A	19: 55,222,930	T623S	possibly damaging	Het
H2-T22	T	C	17: 36,041,542	T164A	probably benign	Het
Herc1	T	A	9: 66,497,599	C4484S	possibly damaging	Het
Hira	T	C	16: 18,947,414	S659P	probably damaging	Het
Hoxa7	T	C	6: 52,217,327	T27A	possibly damaging	Het
Hoxd1	T	C	2: 74,763,522	S141P	probably damaging	Het
Kank1	C	A	19: 25,411,032	Q690K	probably benign	Het
Kera	A	G	10: 97,609,147	K123E	probably benign	Het
Kif1bp	T	C	10: 62,559,327	Y512C	probably damaging	Het
Lepr	A	C	4: 101,735,677	Y163S	probably damaging	Het
Leprotl1	T	C	8: 34,140,768	I29V	probably benign	Het
Mrps15	A	G	4: 126,055,407	K223E	probably damaging	Het
Mrps7	T	A	11: 115,606,985	N225K	probably benign	Het
Nav3	T	A	10: 109,823,323	D811V	probably damaging	Het
Ndst3	T	A	3: 123,548,938	R741S	probably damaging	Het
Nos3	T	C	5: 24,370,133	Y356H	probably damaging	Het
Nxpe3	A	G	16: 55,866,081	V188A	probably damaging	Het
Olfr1057	T	C	2: 86,375,143	K90E	possibly damaging	Het
Olfr469	T	A	7: 107,823,371	I33F	probably benign	Het
Olfr702	T	C	7: 106,824,110	R139G	probably benign	Het
Pdia4	A	T	6: 47,796,761	C551*	probably null	Het
Pex13	A	G	11: 23,655,513	F239S	probably damaging	Het
Pigq	A	G	17: 25,935,006	M273T	probably benign	Het
Plppr2	C	T	9: 21,947,751	P388L	probably damaging	Het
Polr3b	C	T	10: 84,692,922	Q737*	probably null	Het
Ppfibp1	T	C	6: 147,022,259		probably null	Het
Ppfibp2	C	A	7: 107,637,297	D17E	probably damaging	Het
Ptpn13	A	G	5: 103,543,459	D1064G	probably benign	Het
Qtrt2	A	T	16: 43,871,655	S168T	probably damaging	Het
Rbp3	T	C	14: 33,954,644	V183A	probably benign	Het
Shprh	T	C	10: 11,186,911		probably null	Het
Slc39a10	T	C	1: 46,836,070	H24R	probably damaging	Het
Slc7a13	A	T	4: 19,819,046	H82L	probably benign	Het
Sptbn2	A	G	19: 4,732,541	I502V	probably benign	Het
Syne2	C	T	12: 76,109,862	R6811C	probably damaging	Het
Syt12	A	G	19: 4,456,883	V78A	probably benign	Het
Tbck	T	A	3: 132,838,011	D874E	probably benign	Het
Tesc	A	T	5: 118,046,329	I25L	probably damaging	Het
Thoc5	T	G	11: 4,914,608	D351E	probably benign	Het
Tor1aip1	A	T	1: 156,007,562	M180K	probably damaging	Het
Trps1	T	C	15: 50,661,136	S842G	probably damaging	Het
Unc79	A	T	12: 103,134,478	T1858S	probably damaging	Het
Vmn1r193	T	C	13: 22,219,391	T144A	probably benign	Het
Vwa8	T	C	14: 79,081,136	F1046S	probably benign	Het
Wdr26	A	T	1: 181,191,775	W346R	probably damaging	Het
Zfp740	T	A	15: 102,207,901	V22E	probably damaging	Het
Zw10	C	A	9: 49,069,741	S480R	probably damaging	Het

Other mutations in Lrriq1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00988:Lrriq1	APN	10	103161896	missense	probably damaging	0.99
IGL01523:Lrriq1	APN	10	103218116	nonsense	probably null
IGL01637:Lrriq1	APN	10	103215628	missense	probably benign
IGL02019:Lrriq1	APN	10	103178800	missense	probably benign	0.02
IGL02153:Lrriq1	APN	10	103170479	missense	probably benign	0.01
IGL02341:Lrriq1	APN	10	103224941	missense	probably benign	0.03
IGL02343:Lrriq1	APN	10	103234163	splice site	probably benign
IGL02408:Lrriq1	APN	10	103146281	missense	probably benign	0.17
IGL02431:Lrriq1	APN	10	103200639	missense	probably damaging	1.00
IGL02540:Lrriq1	APN	10	103215019	missense	probably benign	0.02
IGL02558:Lrriq1	APN	10	103146283	missense	probably damaging	1.00
IGL02613:Lrriq1	APN	10	103144548	missense	probably damaging	0.99
IGL02642:Lrriq1	APN	10	103221461	critical splice acceptor site	probably null
IGL03027:Lrriq1	APN	10	103227196	missense	probably benign	0.35
PIT4362001:Lrriq1	UTSW	10	103071194	missense	probably benign	0.26
R0050:Lrriq1	UTSW	10	103068931	missense	probably damaging	0.99
R0050:Lrriq1	UTSW	10	103068931	missense	probably damaging	0.99
R0068:Lrriq1	UTSW	10	103063418	missense	probably benign	0.02
R0068:Lrriq1	UTSW	10	103063418	missense	probably benign	0.02
R0124:Lrriq1	UTSW	10	103170420	critical splice donor site	probably null
R0244:Lrriq1	UTSW	10	103215773	missense	probably damaging	0.98
R0323:Lrriq1	UTSW	10	103221289	missense	possibly damaging	0.91
R0515:Lrriq1	UTSW	10	103068968	splice site	probably null
R0522:Lrriq1	UTSW	10	103161777	missense	probably damaging	0.99
R0701:Lrriq1	UTSW	10	103234044	missense	probably benign
R1220:Lrriq1	UTSW	10	103071129	missense	probably benign	0.05
R1261:Lrriq1	UTSW	10	103234137	missense	possibly damaging	0.87
R1262:Lrriq1	UTSW	10	103234137	missense	possibly damaging	0.87
R1451:Lrriq1	UTSW	10	103202515	splice site	probably benign
R1642:Lrriq1	UTSW	10	103214456	missense	probably benign	0.13
R1643:Lrriq1	UTSW	10	103214824	missense	probably benign	0.00
R1647:Lrriq1	UTSW	10	103170648	nonsense	probably null
R1843:Lrriq1	UTSW	10	103227173	splice site	probably null
R2128:Lrriq1	UTSW	10	103214857	missense	probably benign	0.01
R2129:Lrriq1	UTSW	10	103214857	missense	probably benign	0.01
R2199:Lrriq1	UTSW	10	103068913	missense	probably damaging	1.00
R2354:Lrriq1	UTSW	10	103189987	missense	probably damaging	1.00
R2495:Lrriq1	UTSW	10	103202381	missense	probably damaging	0.97
R2897:Lrriq1	UTSW	10	103227250	missense	probably damaging	0.99
R2898:Lrriq1	UTSW	10	103227250	missense	probably damaging	0.99
R2922:Lrriq1	UTSW	10	103214675	missense	probably benign	0.00
R2939:Lrriq1	UTSW	10	103144889	missense	probably damaging	0.98
R2965:Lrriq1	UTSW	10	103214900	missense	probably benign	0.07
R2966:Lrriq1	UTSW	10	103214900	missense	probably benign	0.07
R3081:Lrriq1	UTSW	10	103144889	missense	probably damaging	0.98
R3115:Lrriq1	UTSW	10	103170433	missense	probably benign	0.00
R3745:Lrriq1	UTSW	10	103170856	missense	probably damaging	0.99
R3813:Lrriq1	UTSW	10	103216111	missense	probably damaging	1.00
R3814:Lrriq1	UTSW	10	103216111	missense	probably damaging	1.00
R3885:Lrriq1	UTSW	10	103216106	missense	probably damaging	0.96
R4378:Lrriq1	UTSW	10	103202364	missense	probably damaging	1.00
R4632:Lrriq1	UTSW	10	103221427	missense	probably damaging	1.00
R4633:Lrriq1	UTSW	10	103200563	nonsense	probably null
R4663:Lrriq1	UTSW	10	103063412	missense	possibly damaging	0.88
R4702:Lrriq1	UTSW	10	103215749	missense	possibly damaging	0.65
R4793:Lrriq1	UTSW	10	103170466	missense	probably benign	0.25
R4801:Lrriq1	UTSW	10	103221318	missense	probably benign	0.02
R4802:Lrriq1	UTSW	10	103221318	missense	probably benign	0.02
R4815:Lrriq1	UTSW	10	103144878	missense	probably benign	0.10
R4872:Lrriq1	UTSW	10	103178788	missense	possibly damaging	0.56
R4877:Lrriq1	UTSW	10	103234038	missense	possibly damaging	0.88
R4894:Lrriq1	UTSW	10	103161752	missense	possibly damaging	0.86
R4990:Lrriq1	UTSW	10	103200559	missense	probably damaging	1.00
R4991:Lrriq1	UTSW	10	103200559	missense	probably damaging	1.00
R5011:Lrriq1	UTSW	10	103189923	missense	probably damaging	1.00
R5013:Lrriq1	UTSW	10	103189923	missense	probably damaging	1.00
R5122:Lrriq1	UTSW	10	103187453	missense	probably damaging	1.00
R5282:Lrriq1	UTSW	10	103215345	missense	probably benign	0.01
R5311:Lrriq1	UTSW	10	103214587	missense	probably damaging	1.00
R5567:Lrriq1	UTSW	10	103170596	missense	possibly damaging	0.56
R5643:Lrriq1	UTSW	10	103215440	missense	probably benign	0.00
R5683:Lrriq1	UTSW	10	103173375	missense	probably damaging	1.00
R5916:Lrriq1	UTSW	10	103221382	nonsense	probably null
R6008:Lrriq1	UTSW	10	103170464	missense	probably damaging	1.00
R6022:Lrriq1	UTSW	10	103215534	missense	possibly damaging	0.90
R6224:Lrriq1	UTSW	10	103215757	missense	probably damaging	1.00
R6254:Lrriq1	UTSW	10	103215451	missense	probably benign	0.15
R6311:Lrriq1	UTSW	10	103173393	missense	probably benign	0.03
R6460:Lrriq1	UTSW	10	103200698	missense	probably damaging	1.00
R6502:Lrriq1	UTSW	10	103227184	missense	probably damaging	0.99
R6637:Lrriq1	UTSW	10	103221432	missense	probably benign	0.06
R6719:Lrriq1	UTSW	10	103071116	missense	probably damaging	1.00
R6736:Lrriq1	UTSW	10	103181889	critical splice acceptor site	probably null
R6928:Lrriq1	UTSW	10	103214939	missense	possibly damaging	0.95
R6991:Lrriq1	UTSW	10	103187458	missense	probably damaging	1.00
R7174:Lrriq1	UTSW	10	103224965	missense	probably benign
R7241:Lrriq1	UTSW	10	103215973	missense	probably damaging	1.00
R7248:Lrriq1	UTSW	10	103223750	missense	possibly damaging	0.85
R7287:Lrriq1	UTSW	10	103216016	missense	probably benign	0.00
R7402:Lrriq1	UTSW	10	103221324	missense	possibly damaging	0.87
R7439:Lrriq1	UTSW	10	103214519	missense	probably benign	0.21
R7585:Lrriq1	UTSW	10	103214946	missense	possibly damaging	0.93
R7611:Lrriq1	UTSW	10	103200571	missense	possibly damaging	0.54
R7634:Lrriq1	UTSW	10	103200601	missense	probably damaging	1.00
R7767:Lrriq1	UTSW	10	103215954	missense	probably damaging	0.99
R7809:Lrriq1	UTSW	10	103215817	missense	probably damaging	0.99
R7910:Lrriq1	UTSW	10	103215194	nonsense	probably null
R8131:Lrriq1	UTSW	10	103215711	missense	possibly damaging	0.57
R8156:Lrriq1	UTSW	10	103156335	critical splice donor site	probably null
R8211:Lrriq1	UTSW	10	103170547	missense	probably damaging	1.00
R8304:Lrriq1	UTSW	10	103234068	missense	possibly damaging	0.57
R8487:Lrriq1	UTSW	10	103215053	missense	probably damaging	0.98
R8500:Lrriq1	UTSW	10	103046155	missense
R9013:Lrriq1	UTSW	10	103215070	missense	probably damaging	1.00
R9099:Lrriq1	UTSW	10	103216003	missense	probably damaging	0.98
R9155:Lrriq1	UTSW	10	103214779	missense	probably benign	0.03
R9320:Lrriq1	UTSW	10	103221283	missense	probably benign
R9384:Lrriq1	UTSW	10	103170597	missense	probably benign	0.00
R9469:Lrriq1	UTSW	10	103214900	missense	probably benign	0.07
R9585:Lrriq1	UTSW	10	103215389	missense	probably benign
R9706:Lrriq1	UTSW	10	103046041	missense
R9780:Lrriq1	UTSW	10	103189963	missense	probably damaging	1.00
X0026:Lrriq1	UTSW	10	103215704	nonsense	probably null
Z1088:Lrriq1	UTSW	10	103202446	missense	probably damaging	1.00
Z1176:Lrriq1	UTSW	10	103202359	missense	probably damaging	1.00
Z1176:Lrriq1	UTSW	10	103202360	missense	probably damaging	1.00
Z1176:Lrriq1	UTSW	10	103234085	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGCCTGTAAATCCAAGCAAGTG -3'
(R):5'- AACACCATATTTTCAGCATCTTATCA -3'

Sequencing Primer
(F):5'- TCCAAGCAAGTGTGAAATAAACTC -3'
(R):5'- GCACAATGGCGTAGTTAC -3'

Posted On

2014-06-23