Incidental Mutation 'R1830:Rbp3'
ID207269
Institutional Source Beutler Lab
Gene Symbol Rbp3
Ensembl Gene ENSMUSG00000041534
Gene Nameretinol binding protein 3, interstitial
SynonymsRbp-3, Irbp
MMRRC Submission 039857-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.720) question?
Stock #R1830 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location33954003-33964216 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33954644 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 183 (V183A)
Ref Sequence ENSEMBL: ENSMUSP00000040249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035695]
Predicted Effect probably benign
Transcript: ENSMUST00000035695
AA Change: V183A

PolyPhen 2 Score 0.309 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000040249
Gene: ENSMUSG00000041534
AA Change: V183A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
TSPc 109 308 5.72e-69 SMART
TSPc 416 616 1.98e-63 SMART
TSPc 720 917 5.34e-69 SMART
TSPc 1019 1216 2.13e-68 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interphotoreceptor retinol-binding protein is a large glycoprotein known to bind retinoids and found primarily in the interphotoreceptor matrix of the retina between the retinal pigment epithelium and the photoreceptor cells. It is thought to transport retinoids between the retinal pigment epithelium and the photoreceptors, a critical role in the visual process.The human IRBP gene is approximately 9.5 kbp in length and consists of four exons separated by three introns. The introns are 1.6-1.9 kbp long. The gene is transcribed by photoreceptor and retinoblastoma cells into an approximately 4.3-kilobase mRNA that is translated and processed into a glycosylated protein of 135,000 Da. The amino acid sequence of human IRBP can be divided into four contiguous homology domains with 33-38% identity, suggesting a series of gene duplication events. In the gene, the boundaries of these domains are not defined by exon-intron junctions, as might have been expected. The first three homology domains and part of the fourth are all encoded by the first large exon, which is 3,180 base pairs long. The remainder of the fourth domain is encoded in the last three exons, which are 191, 143, and approximately 740 base pairs long, respectively. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene experience photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik T C 17: 25,946,717 D532G possibly damaging Het
Abca13 T C 11: 9,290,350 S738P probably benign Het
Abi3bp C A 16: 56,587,985 P261Q probably damaging Het
Adam19 A G 11: 46,127,278 N389S probably damaging Het
Adgrv1 A T 13: 81,489,077 V3415D possibly damaging Het
Ankrd33 A T 15: 101,119,551 I282F probably damaging Het
Arhgap39 C T 15: 76,735,183 V734M probably damaging Het
Arsg T C 11: 109,563,274 probably null Het
Atp8b4 C T 2: 126,403,381 G283R probably benign Het
B3galnt2 T G 13: 13,991,534 L338* probably null Het
C87414 A T 5: 93,637,686 I245K probably benign Het
Cdc14a A T 3: 116,422,647 Y1* probably null Het
Ceacam16 T C 7: 19,858,878 E35G possibly damaging Het
Cfap46 T A 7: 139,640,407 D1244V possibly damaging Het
Chordc1 T C 9: 18,311,978 Y245H probably damaging Het
Col6a6 C A 9: 105,702,270 V1919F probably damaging Het
Colgalt1 T C 8: 71,623,137 V476A probably damaging Het
Cped1 T C 6: 22,237,728 C948R probably damaging Het
Cyfip2 T C 11: 46,199,019 D1189G probably damaging Het
Cyp27b1 T C 10: 127,049,083 Y72H possibly damaging Het
Dagla A G 19: 10,271,014 M94T probably benign Het
Dip2a A G 10: 76,317,963 S178P probably damaging Het
Dlec1 T C 9: 119,138,790 V1220A probably benign Het
Dpysl2 T C 14: 66,868,391 probably benign Het
E2f6 T C 12: 16,818,883 V69A probably benign Het
Fat3 T C 9: 15,915,340 T4439A probably benign Het
Fn1 T C 1: 71,624,259 I1023M probably damaging Het
Gabrr2 G A 4: 33,077,481 V83M probably damaging Het
Gfral T C 9: 76,193,203 N318D probably benign Het
Gm5611 A T 9: 17,030,777 noncoding transcript Het
Gpat3 A T 5: 100,893,180 M369L probably benign Het
Grik5 T C 7: 25,046,301 D449G possibly damaging Het
Gucy2g T A 19: 55,222,930 T623S possibly damaging Het
H2-T22 T C 17: 36,041,542 T164A probably benign Het
Herc1 T A 9: 66,497,599 C4484S possibly damaging Het
Hira T C 16: 18,947,414 S659P probably damaging Het
Hoxa7 T C 6: 52,217,327 T27A possibly damaging Het
Hoxd1 T C 2: 74,763,522 S141P probably damaging Het
Kank1 C A 19: 25,411,032 Q690K probably benign Het
Kera A G 10: 97,609,147 K123E probably benign Het
Kif1bp T C 10: 62,559,327 Y512C probably damaging Het
Lepr A C 4: 101,735,677 Y163S probably damaging Het
Leprotl1 T C 8: 34,140,768 I29V probably benign Het
Lrriq1 T G 10: 103,161,759 T1332P probably benign Het
Mrps15 A G 4: 126,055,407 K223E probably damaging Het
Mrps7 T A 11: 115,606,985 N225K probably benign Het
Nav3 T A 10: 109,823,323 D811V probably damaging Het
Ndst3 T A 3: 123,548,938 R741S probably damaging Het
Nos3 T C 5: 24,370,133 Y356H probably damaging Het
Nxpe3 A G 16: 55,866,081 V188A probably damaging Het
Olfr1057 T C 2: 86,375,143 K90E possibly damaging Het
Olfr469 T A 7: 107,823,371 I33F probably benign Het
Olfr702 T C 7: 106,824,110 R139G probably benign Het
Pdia4 A T 6: 47,796,761 C551* probably null Het
Pex13 A G 11: 23,655,513 F239S probably damaging Het
Pigq A G 17: 25,935,006 M273T probably benign Het
Plppr2 C T 9: 21,947,751 P388L probably damaging Het
Polr3b C T 10: 84,692,922 Q737* probably null Het
Ppfibp1 T C 6: 147,022,259 probably null Het
Ppfibp2 C A 7: 107,637,297 D17E probably damaging Het
Ptpn13 A G 5: 103,543,459 D1064G probably benign Het
Qtrt2 A T 16: 43,871,655 S168T probably damaging Het
Shprh T C 10: 11,186,911 probably null Het
Slc39a10 T C 1: 46,836,070 H24R probably damaging Het
Slc7a13 A T 4: 19,819,046 H82L probably benign Het
Sptbn2 A G 19: 4,732,541 I502V probably benign Het
Syne2 C T 12: 76,109,862 R6811C probably damaging Het
Syt12 A G 19: 4,456,883 V78A probably benign Het
Tbck T A 3: 132,838,011 D874E probably benign Het
Tesc A T 5: 118,046,329 I25L probably damaging Het
Thoc5 T G 11: 4,914,608 D351E probably benign Het
Tor1aip1 A T 1: 156,007,562 M180K probably damaging Het
Trps1 T C 15: 50,661,136 S842G probably damaging Het
Unc79 A T 12: 103,134,478 T1858S probably damaging Het
Vmn1r193 T C 13: 22,219,391 T144A probably benign Het
Vwa8 T C 14: 79,081,136 F1046S probably benign Het
Wdr26 A T 1: 181,191,775 W346R probably damaging Het
Zfp740 T A 15: 102,207,901 V22E probably damaging Het
Zw10 C A 9: 49,069,741 S480R probably damaging Het
Other mutations in Rbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Rbp3 APN 14 33954188 missense possibly damaging 0.82
IGL01643:Rbp3 APN 14 33956836 missense probably benign 0.18
IGL01665:Rbp3 APN 14 33956131 missense probably benign 0.02
IGL01809:Rbp3 APN 14 33955300 missense probably damaging 1.00
IGL01975:Rbp3 APN 14 33958645 missense probably damaging 1.00
IGL02349:Rbp3 APN 14 33955719 missense probably damaging 0.97
IGL02447:Rbp3 APN 14 33954503 missense probably damaging 1.00
IGL03192:Rbp3 APN 14 33958583 missense possibly damaging 0.52
IGL03302:Rbp3 APN 14 33954659 missense probably damaging 0.97
Behagt UTSW 14 33954454 missense probably benign 0.00
jagt UTSW 14 33956482 missense probably damaging 0.97
muntre UTSW 14 33956356 missense possibly damaging 0.95
Rotwild UTSW 14 33956018 missense probably damaging 1.00
P4717OSA:Rbp3 UTSW 14 33955499 missense probably damaging 0.96
R0234:Rbp3 UTSW 14 33955901 missense probably damaging 0.98
R0234:Rbp3 UTSW 14 33955901 missense probably damaging 0.98
R0432:Rbp3 UTSW 14 33954773 missense probably damaging 1.00
R0469:Rbp3 UTSW 14 33962419 missense possibly damaging 0.95
R0652:Rbp3 UTSW 14 33958648 missense possibly damaging 0.89
R0739:Rbp3 UTSW 14 33958647 missense probably benign 0.28
R0747:Rbp3 UTSW 14 33956278 missense possibly damaging 0.51
R0836:Rbp3 UTSW 14 33956638 missense possibly damaging 0.84
R1102:Rbp3 UTSW 14 33956356 missense possibly damaging 0.95
R1583:Rbp3 UTSW 14 33954524 missense possibly damaging 0.45
R1589:Rbp3 UTSW 14 33955792 missense probably damaging 0.99
R1595:Rbp3 UTSW 14 33956198 missense possibly damaging 0.93
R1720:Rbp3 UTSW 14 33956909 missense probably benign 0.38
R1982:Rbp3 UTSW 14 33954545 missense probably damaging 0.99
R1985:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R1985:Rbp3 UTSW 14 33956461 missense probably benign 0.00
R2007:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2027:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2100:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2101:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2113:Rbp3 UTSW 14 33956057 missense probably benign 0.00
R2138:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2183:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2248:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2277:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2306:Rbp3 UTSW 14 33962563 missense probably damaging 1.00
R2504:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2696:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2697:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2698:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2920:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2940:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2971:Rbp3 UTSW 14 33954454 missense probably benign 0.00
R3111:Rbp3 UTSW 14 33954112 missense probably benign 0.01
R3155:Rbp3 UTSW 14 33957114 missense probably damaging 0.98
R3156:Rbp3 UTSW 14 33957114 missense probably damaging 0.98
R3751:Rbp3 UTSW 14 33956012 missense probably damaging 0.98
R3752:Rbp3 UTSW 14 33956012 missense probably damaging 0.98
R3851:Rbp3 UTSW 14 33955507 missense probably damaging 0.98
R4016:Rbp3 UTSW 14 33955390 missense possibly damaging 0.82
R4276:Rbp3 UTSW 14 33958650 missense probably benign 0.24
R4277:Rbp3 UTSW 14 33958650 missense probably benign 0.24
R4278:Rbp3 UTSW 14 33958650 missense probably benign 0.24
R4382:Rbp3 UTSW 14 33955296 missense probably benign 0.12
R4383:Rbp3 UTSW 14 33955296 missense probably benign 0.12
R4385:Rbp3 UTSW 14 33955296 missense probably benign 0.12
R4625:Rbp3 UTSW 14 33956099 missense probably benign
R4712:Rbp3 UTSW 14 33960658 missense probably damaging 0.97
R4812:Rbp3 UTSW 14 33954774 missense probably damaging 0.99
R4918:Rbp3 UTSW 14 33955411 missense probably damaging 1.00
R4971:Rbp3 UTSW 14 33954470 missense probably damaging 0.98
R5262:Rbp3 UTSW 14 33954850 missense probably damaging 1.00
R5387:Rbp3 UTSW 14 33956413 missense possibly damaging 0.95
R5468:Rbp3 UTSW 14 33956627 missense possibly damaging 0.93
R5837:Rbp3 UTSW 14 33954273 missense probably benign 0.00
R5994:Rbp3 UTSW 14 33954900 missense probably damaging 1.00
R6010:Rbp3 UTSW 14 33954647 missense probably damaging 1.00
R6041:Rbp3 UTSW 14 33956482 missense probably damaging 0.97
R6266:Rbp3 UTSW 14 33954461 missense probably benign
R6357:Rbp3 UTSW 14 33957034 missense probably damaging 0.99
R6457:Rbp3 UTSW 14 33955267 nonsense probably null
R6777:Rbp3 UTSW 14 33954273 missense probably benign 0.00
R7158:Rbp3 UTSW 14 33955556 missense probably benign 0.00
R7183:Rbp3 UTSW 14 33955204 missense probably benign 0.02
R7256:Rbp3 UTSW 14 33962583 missense possibly damaging 0.93
R7654:Rbp3 UTSW 14 33955840 missense probably benign
R7756:Rbp3 UTSW 14 33954775 missense probably benign 0.15
R7758:Rbp3 UTSW 14 33954775 missense probably benign 0.15
R7784:Rbp3 UTSW 14 33954158 missense probably benign 0.41
R7845:Rbp3 UTSW 14 33956464 missense probably benign 0.24
R8176:Rbp3 UTSW 14 33955648 missense possibly damaging 0.67
R8281:Rbp3 UTSW 14 33956363 missense probably benign 0.00
R8393:Rbp3 UTSW 14 33956199 missense possibly damaging 0.93
Z1177:Rbp3 UTSW 14 33954538 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- GGCCCAGATACAGAGGAACATC -3'
(R):5'- CTTCAGGATGTAGGCAATGTCC -3'

Sequencing Primer
(F):5'- GAACATCCGCCATGAGGTTCTTG -3'
(R):5'- ATGTAGGCAATGTCCTCTGCGAC -3'
Posted On2014-06-23