Incidental Mutation 'R0115:Alas1'
Institutional Source Beutler Lab
Gene Symbol Alas1
Ensembl Gene ENSMUSG00000032786
Gene Nameaminolevulinic acid synthase 1
Synonymssuccinyl-CoA: glycine C-succinyl transferase, Alas-1, ALAS-N, 5-aminolevulinate synthase
MMRRC Submission 038401-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0115 (G1)
Quality Score225
Status Validated (trace)
Chromosomal Location106233455-106248654 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 106238252 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074082] [ENSMUST00000112524] [ENSMUST00000133617] [ENSMUST00000141118] [ENSMUST00000143125] [ENSMUST00000214989] [ENSMUST00000215222] [ENSMUST00000219129]
Predicted Effect probably null
Transcript: ENSMUST00000074082
SMART Domains Protein: ENSMUSP00000073725
Gene: ENSMUSG00000032786

Pfam:Preseq_ALAS 1 81 1.1e-21 PFAM
Pfam:Preseq_ALAS 73 141 2.8e-12 PFAM
Pfam:Aminotran_1_2 245 591 2.1e-77 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000112524
SMART Domains Protein: ENSMUSP00000108143
Gene: ENSMUSG00000032786

Pfam:Preseq_ALAS 2 140 1.3e-49 PFAM
Pfam:Aminotran_1_2 245 592 5.3e-80 PFAM
Pfam:Cys_Met_Meta_PP 283 423 1.5e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123115
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123601
Predicted Effect probably benign
Transcript: ENSMUST00000133617
SMART Domains Protein: ENSMUSP00000122117
Gene: ENSMUSG00000032786

Pfam:Preseq_ALAS 1 79 3.1e-22 PFAM
Pfam:Preseq_ALAS 73 141 8.7e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134053
Predicted Effect probably null
Transcript: ENSMUST00000141118
SMART Domains Protein: ENSMUSP00000117014
Gene: ENSMUSG00000032786

Pfam:Preseq_ALAS 1 81 1.7e-20 PFAM
Pfam:Preseq_ALAS 73 141 4.2e-11 PFAM
Pfam:Aminotran_1_2 245 592 5.3e-80 PFAM
Pfam:Aminotran_5 257 422 3.4e-6 PFAM
Pfam:Cys_Met_Meta_PP 285 423 1.8e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143125
SMART Domains Protein: ENSMUSP00000119968
Gene: ENSMUSG00000032786

Pfam:Aminotran_5 1 61 7.7e-7 PFAM
Pfam:Aminotran_1_2 1 93 2.2e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214249
Predicted Effect probably benign
Transcript: ENSMUST00000214989
Predicted Effect probably benign
Transcript: ENSMUST00000215222
Predicted Effect probably benign
Transcript: ENSMUST00000219129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219340
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.2%
  • 20x: 86.0%
Validation Efficiency 98% (98/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the mitochondrial enzyme which is catalyzes the rate-limiting step in heme (iron-protoporphyrin) biosynthesis. The enzyme encoded by this gene is the housekeeping enzyme; a separate gene encodes a form of the enzyme that is specific for erythroid tissue. The level of the mature encoded protein is regulated by heme: high levels of heme down-regulate the mature enzyme in mitochondria while low heme levels up-regulate. A pseudogene of this gene is located on chromosome 12. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a reporter allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik G A 18: 57,594,142 probably benign Het
2310007B03Rik A T 1: 93,159,725 S135R possibly damaging Het
4921528I07Rik A G 9: 114,279,384 noncoding transcript Het
Arf5 A G 6: 28,426,076 Y154C probably damaging Het
Arhgap20 T A 9: 51,838,972 I344N probably damaging Het
Arhgap30 A C 1: 171,407,948 E630A possibly damaging Het
B4galt5 A G 2: 167,309,234 L118P probably damaging Het
Bdp1 A G 13: 100,041,454 I1969T probably benign Het
Bysl C T 17: 47,610,942 R77Q probably benign Het
Cap1 A T 4: 122,863,075 H272Q possibly damaging Het
Ccdc146 T C 5: 21,322,756 I187M possibly damaging Het
Cdk13 C A 13: 17,719,494 A1123S probably damaging Het
Ces5a A T 8: 93,502,183 M473K probably damaging Het
Chd8 A G 14: 52,237,206 S123P probably benign Het
Cwc22 G A 2: 77,908,111 A497V probably damaging Het
Cwh43 T C 5: 73,418,027 S296P probably damaging Het
Cyp2c50 T A 19: 40,092,393 probably benign Het
Dlg1 C A 16: 31,805,690 Y399* probably null Het
Drosha A T 15: 12,846,130 E92D probably benign Het
Fanca C T 8: 123,268,539 G1408D probably benign Het
Frem1 T A 4: 82,936,169 D1621V possibly damaging Het
Frem2 G A 3: 53,656,208 R293C probably damaging Het
Fut8 T A 12: 77,448,560 V308D probably damaging Het
Glipr1 A G 10: 111,993,541 I105T probably benign Het
Glmn A T 5: 107,560,934 S385T probably benign Het
Gm281 A G 14: 13,899,571 V117A probably damaging Het
Gon4l T A 3: 88,895,682 V1200D probably damaging Het
Gpc1 G A 1: 92,857,499 D387N probably damaging Het
Gsdmc A G 15: 63,803,637 Y110H probably damaging Het
Gucy1b1 T A 3: 82,034,391 H586L probably benign Het
Gucy2e A G 11: 69,236,632 L5P unknown Het
Hectd4 A G 5: 121,295,506 probably benign Het
Hmcn1 T A 1: 150,808,647 I391F possibly damaging Het
Hsf4 A T 8: 105,272,704 probably null Het
I830077J02Rik G A 3: 105,926,570 T90M probably damaging Het
Ino80 A T 2: 119,431,016 H722Q probably damaging Het
Kcnma1 C A 14: 23,314,175 R980L probably damaging Het
Kif1a A G 1: 93,046,778 probably benign Het
Klhdc7b A G 15: 89,388,521 H1202R probably benign Het
Lig3 A G 11: 82,793,935 D559G probably damaging Het
Lyst T C 13: 13,677,952 V2179A probably benign Het
Mansc4 A G 6: 147,075,227 I297T possibly damaging Het
March6 A T 15: 31,475,812 F633I probably benign Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Megf10 G T 18: 57,259,802 V424L possibly damaging Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mib2 A G 4: 155,656,062 probably benign Het
Mut C T 17: 40,956,227 T564M probably damaging Het
Myh8 A G 11: 67,306,264 probably benign Het
Mypn T C 10: 63,192,380 probably benign Het
Nf1 G A 11: 79,468,876 probably null Het
Notch3 T A 17: 32,133,462 T1866S possibly damaging Het
Olfr108 C T 17: 37,445,779 A86V probably benign Het
Olfr1189 A T 2: 88,592,655 I284F probably damaging Het
Olfr1301 T A 2: 111,754,585 M112K probably damaging Het
Olfr390 A G 11: 73,787,315 I126V possibly damaging Het
Pkhd1 A T 1: 20,350,490 I2464N probably damaging Het
Pkn1 A G 8: 83,671,029 S817P probably damaging Het
Prkg2 A T 5: 98,994,655 probably null Het
Prl8a6 T C 13: 27,433,101 D201G probably benign Het
Psmd1 C T 1: 86,083,271 T356I possibly damaging Het
Ptk6 G A 2: 181,202,527 probably benign Het
Ptprn2 T C 12: 117,211,846 probably benign Het
Rbm42 G A 7: 30,647,775 T106I probably damaging Het
Rims4 A T 2: 163,864,120 V198E probably damaging Het
Ripk1 T C 13: 34,009,750 S32P probably damaging Het
Rorc T C 3: 94,377,609 probably benign Het
Rpl22l1 T C 3: 28,806,536 F15L probably damaging Het
Slc6a20a C A 9: 123,678,758 A17S possibly damaging Het
Sorcs1 A G 19: 50,636,453 probably benign Het
Sp100 A G 1: 85,650,131 probably benign Het
Ssc5d G A 7: 4,927,881 probably benign Het
Taf11 A G 17: 27,907,661 L4P probably benign Het
Tm2d3 A G 7: 65,695,334 probably benign Het
Tmub2 T C 11: 102,288,375 probably null Het
Trim34a T A 7: 104,247,902 C58S probably damaging Het
Trpc3 T C 3: 36,624,417 I840V probably benign Het
Trpm6 T C 19: 18,829,952 V1020A probably damaging Het
Vmn1r214 T A 13: 23,035,294 Y319* probably null Het
Vmn1r59 T C 7: 5,454,116 N215S probably benign Het
Vmn2r74 T C 7: 85,957,356 M261V probably benign Het
Vmn2r89 T C 14: 51,456,120 F309S probably damaging Het
Wdr95 A T 5: 149,564,390 D163V probably damaging Het
Xirp2 T A 2: 67,509,909 F831L possibly damaging Het
Ythdc2 C T 18: 44,841,423 probably benign Het
Other mutations in Alas1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Alas1 APN 9 106236472 missense probably benign 0.17
IGL02165:Alas1 APN 9 106238783 missense probably damaging 1.00
IGL02355:Alas1 APN 9 106236639 missense probably damaging 1.00
IGL02362:Alas1 APN 9 106236639 missense probably damaging 1.00
IGL02499:Alas1 APN 9 106241321 missense probably damaging 1.00
IGL02606:Alas1 APN 9 106241110 unclassified probably benign
IGL03121:Alas1 APN 9 106246914 missense probably damaging 0.99
R0294:Alas1 UTSW 9 106241256 missense probably damaging 1.00
R0333:Alas1 UTSW 9 106241281 missense probably benign 0.08
R0346:Alas1 UTSW 9 106243351 missense possibly damaging 0.78
R1700:Alas1 UTSW 9 106239646 missense possibly damaging 0.46
R1982:Alas1 UTSW 9 106238185 missense probably damaging 1.00
R2056:Alas1 UTSW 9 106241290 missense probably damaging 1.00
R2058:Alas1 UTSW 9 106241290 missense probably damaging 1.00
R2059:Alas1 UTSW 9 106241290 missense probably damaging 1.00
R2355:Alas1 UTSW 9 106236474 missense probably damaging 0.96
R2516:Alas1 UTSW 9 106238660 missense probably damaging 1.00
R3896:Alas1 UTSW 9 106241801 intron probably null
R4091:Alas1 UTSW 9 106241801 intron probably null
R4093:Alas1 UTSW 9 106241801 intron probably null
R4095:Alas1 UTSW 9 106241801 intron probably null
R4673:Alas1 UTSW 9 106236477 missense probably damaging 1.00
R4948:Alas1 UTSW 9 106246878 nonsense probably null
R5165:Alas1 UTSW 9 106241255 missense probably damaging 1.00
R5215:Alas1 UTSW 9 106243375 missense probably benign 0.05
R5420:Alas1 UTSW 9 106234159 missense probably benign 0.13
R5993:Alas1 UTSW 9 106234129 missense probably benign 0.11
R6033:Alas1 UTSW 9 106241204 missense probably damaging 1.00
R6033:Alas1 UTSW 9 106241204 missense probably damaging 1.00
R7489:Alas1 UTSW 9 106241634 critical splice donor site probably null
R7726:Alas1 UTSW 9 106246951 missense probably benign 0.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- acatggatgttacatggatgttac -3'
Posted On2013-04-11