Incidental Mutation 'R1830:Trps1'
ID207272
Institutional Source Beutler Lab
Gene Symbol Trps1
Ensembl Gene ENSMUSG00000038679
Gene Nametranscriptional repressor GATA binding 1
SynonymsD15Ertd586e
MMRRC Submission 039857-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1830 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location50654752-50890463 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50661136 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 842 (S842G)
Ref Sequence ENSEMBL: ENSMUSP00000139063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077935] [ENSMUST00000165201] [ENSMUST00000183757] [ENSMUST00000183997] [ENSMUST00000184458] [ENSMUST00000184885]
Predicted Effect probably damaging
Transcript: ENSMUST00000077935
AA Change: S1129G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000077089
Gene: ENSMUSG00000038679
AA Change: S1129G

DomainStartEndE-ValueType
ZnF_C2H2 222 247 1.41e0 SMART
ZnF_C2H2 333 358 4.45e0 SMART
ZnF_C2H2 434 459 1.31e2 SMART
ZnF_C2H2 523 554 1.93e2 SMART
low complexity region 597 602 N/A INTRINSIC
ZnF_C2H2 614 637 8.67e-1 SMART
ZnF_C2H2 666 689 2.29e0 SMART
ZnF_C2H2 692 715 8.22e-2 SMART
low complexity region 766 779 N/A INTRINSIC
ZnF_GATA 890 940 3.95e-16 SMART
low complexity region 1050 1062 N/A INTRINSIC
ZnF_C2H2 1215 1237 4.34e0 SMART
ZnF_C2H2 1243 1267 5.72e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165201
AA Change: S1129G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129779
Gene: ENSMUSG00000038679
AA Change: S1129G

DomainStartEndE-ValueType
ZnF_C2H2 222 247 1.41e0 SMART
ZnF_C2H2 333 358 4.45e0 SMART
ZnF_C2H2 434 459 1.31e2 SMART
ZnF_C2H2 523 554 1.93e2 SMART
low complexity region 597 602 N/A INTRINSIC
ZnF_C2H2 614 637 8.67e-1 SMART
ZnF_C2H2 666 689 2.29e0 SMART
ZnF_C2H2 692 715 8.22e-2 SMART
low complexity region 766 779 N/A INTRINSIC
ZnF_GATA 890 940 3.95e-16 SMART
low complexity region 1050 1062 N/A INTRINSIC
ZnF_C2H2 1215 1237 4.34e0 SMART
ZnF_C2H2 1243 1267 5.72e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000183757
AA Change: S1133G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139017
Gene: ENSMUSG00000038679
AA Change: S1133G

DomainStartEndE-ValueType
ZnF_C2H2 226 251 1.41e0 SMART
ZnF_C2H2 337 362 4.45e0 SMART
ZnF_C2H2 438 463 1.31e2 SMART
ZnF_C2H2 527 558 1.93e2 SMART
low complexity region 601 606 N/A INTRINSIC
ZnF_C2H2 618 641 8.67e-1 SMART
ZnF_C2H2 670 693 2.29e0 SMART
ZnF_C2H2 696 719 8.22e-2 SMART
low complexity region 770 783 N/A INTRINSIC
ZnF_GATA 894 944 3.95e-16 SMART
low complexity region 1054 1066 N/A INTRINSIC
ZnF_C2H2 1219 1241 4.34e0 SMART
ZnF_C2H2 1247 1271 5.72e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000183997
AA Change: S944G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139115
Gene: ENSMUSG00000038679
AA Change: S944G

DomainStartEndE-ValueType
ZnF_C2H2 226 251 1.41e0 SMART
ZnF_C2H2 337 362 4.45e0 SMART
ZnF_C2H2 470 493 2.29e0 SMART
ZnF_C2H2 496 519 8.22e-2 SMART
low complexity region 570 583 N/A INTRINSIC
ZnF_GATA 705 755 3.95e-16 SMART
low complexity region 865 877 N/A INTRINSIC
ZnF_C2H2 1030 1052 4.34e0 SMART
ZnF_C2H2 1058 1082 5.72e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000184458
AA Change: S842G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139063
Gene: ENSMUSG00000038679
AA Change: S842G

DomainStartEndE-ValueType
ZnF_C2H2 46 71 4.45e0 SMART
ZnF_C2H2 147 172 1.31e2 SMART
ZnF_C2H2 236 267 1.93e2 SMART
low complexity region 310 315 N/A INTRINSIC
ZnF_C2H2 327 350 8.67e-1 SMART
ZnF_C2H2 379 402 2.29e0 SMART
ZnF_C2H2 405 428 8.22e-2 SMART
low complexity region 479 492 N/A INTRINSIC
ZnF_GATA 603 653 3.95e-16 SMART
low complexity region 763 775 N/A INTRINSIC
ZnF_C2H2 928 950 4.34e0 SMART
ZnF_C2H2 956 980 5.72e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000184885
AA Change: S883G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138905
Gene: ENSMUSG00000038679
AA Change: S883G

DomainStartEndE-ValueType
ZnF_C2H2 176 201 1.41e0 SMART
ZnF_C2H2 287 312 4.45e0 SMART
ZnF_C2H2 420 443 2.29e0 SMART
ZnF_C2H2 446 469 8.22e-2 SMART
low complexity region 520 533 N/A INTRINSIC
ZnF_GATA 644 694 3.95e-16 SMART
low complexity region 804 816 N/A INTRINSIC
ZnF_C2H2 969 991 4.34e0 SMART
ZnF_C2H2 997 1021 5.72e-1 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that represses GATA-regulated genes and binds to a dynein light chain protein. Binding of the encoded protein to the dynein light chain protein affects binding to GATA consensus sequences and suppresses its transcriptional activity. Defects in this gene are a cause of tricho-rhino-phalangeal syndrome (TRPS) types I-III. [provided by RefSeq, Jul 2008]
PHENOTYPE: Newborn mice homozygous for a knock-out allele exhibit craniofacial and hair anomalies and die of respiratory failure due to thoracic spine and rib defects. Mice homozygous for a reporter allele show additional defects in chondrocyte proliferation and apoptosis as well as reduced nephron formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik T C 17: 25,946,717 D532G possibly damaging Het
Abca13 T C 11: 9,290,350 S738P probably benign Het
Abi3bp C A 16: 56,587,985 P261Q probably damaging Het
Adam19 A G 11: 46,127,278 N389S probably damaging Het
Adgrv1 A T 13: 81,489,077 V3415D possibly damaging Het
Ankrd33 A T 15: 101,119,551 I282F probably damaging Het
Arhgap39 C T 15: 76,735,183 V734M probably damaging Het
Arsg T C 11: 109,563,274 probably null Het
Atp8b4 C T 2: 126,403,381 G283R probably benign Het
B3galnt2 T G 13: 13,991,534 L338* probably null Het
C87414 A T 5: 93,637,686 I245K probably benign Het
Cdc14a A T 3: 116,422,647 Y1* probably null Het
Ceacam16 T C 7: 19,858,878 E35G possibly damaging Het
Cfap46 T A 7: 139,640,407 D1244V possibly damaging Het
Chordc1 T C 9: 18,311,978 Y245H probably damaging Het
Col6a6 C A 9: 105,702,270 V1919F probably damaging Het
Colgalt1 T C 8: 71,623,137 V476A probably damaging Het
Cped1 T C 6: 22,237,728 C948R probably damaging Het
Cyfip2 T C 11: 46,199,019 D1189G probably damaging Het
Cyp27b1 T C 10: 127,049,083 Y72H possibly damaging Het
Dagla A G 19: 10,271,014 M94T probably benign Het
Dip2a A G 10: 76,317,963 S178P probably damaging Het
Dlec1 T C 9: 119,138,790 V1220A probably benign Het
Dpysl2 T C 14: 66,868,391 probably benign Het
E2f6 T C 12: 16,818,883 V69A probably benign Het
Fat3 T C 9: 15,915,340 T4439A probably benign Het
Fn1 T C 1: 71,624,259 I1023M probably damaging Het
Gabrr2 G A 4: 33,077,481 V83M probably damaging Het
Gfral T C 9: 76,193,203 N318D probably benign Het
Gm5611 A T 9: 17,030,777 noncoding transcript Het
Gpat3 A T 5: 100,893,180 M369L probably benign Het
Grik5 T C 7: 25,046,301 D449G possibly damaging Het
Gucy2g T A 19: 55,222,930 T623S possibly damaging Het
H2-T22 T C 17: 36,041,542 T164A probably benign Het
Herc1 T A 9: 66,497,599 C4484S possibly damaging Het
Hira T C 16: 18,947,414 S659P probably damaging Het
Hoxa7 T C 6: 52,217,327 T27A possibly damaging Het
Hoxd1 T C 2: 74,763,522 S141P probably damaging Het
Kank1 C A 19: 25,411,032 Q690K probably benign Het
Kera A G 10: 97,609,147 K123E probably benign Het
Kif1bp T C 10: 62,559,327 Y512C probably damaging Het
Lepr A C 4: 101,735,677 Y163S probably damaging Het
Leprotl1 T C 8: 34,140,768 I29V probably benign Het
Lrriq1 T G 10: 103,161,759 T1332P probably benign Het
Mrps15 A G 4: 126,055,407 K223E probably damaging Het
Mrps7 T A 11: 115,606,985 N225K probably benign Het
Nav3 T A 10: 109,823,323 D811V probably damaging Het
Ndst3 T A 3: 123,548,938 R741S probably damaging Het
Nos3 T C 5: 24,370,133 Y356H probably damaging Het
Nxpe3 A G 16: 55,866,081 V188A probably damaging Het
Olfr1057 T C 2: 86,375,143 K90E possibly damaging Het
Olfr469 T A 7: 107,823,371 I33F probably benign Het
Olfr702 T C 7: 106,824,110 R139G probably benign Het
Pdia4 A T 6: 47,796,761 C551* probably null Het
Pex13 A G 11: 23,655,513 F239S probably damaging Het
Pigq A G 17: 25,935,006 M273T probably benign Het
Plppr2 C T 9: 21,947,751 P388L probably damaging Het
Polr3b C T 10: 84,692,922 Q737* probably null Het
Ppfibp1 T C 6: 147,022,259 probably null Het
Ppfibp2 C A 7: 107,637,297 D17E probably damaging Het
Ptpn13 A G 5: 103,543,459 D1064G probably benign Het
Qtrt2 A T 16: 43,871,655 S168T probably damaging Het
Rbp3 T C 14: 33,954,644 V183A probably benign Het
Shprh T C 10: 11,186,911 probably null Het
Slc39a10 T C 1: 46,836,070 H24R probably damaging Het
Slc7a13 A T 4: 19,819,046 H82L probably benign Het
Sptbn2 A G 19: 4,732,541 I502V probably benign Het
Syne2 C T 12: 76,109,862 R6811C probably damaging Het
Syt12 A G 19: 4,456,883 V78A probably benign Het
Tbck T A 3: 132,838,011 D874E probably benign Het
Tesc A T 5: 118,046,329 I25L probably damaging Het
Thoc5 T G 11: 4,914,608 D351E probably benign Het
Tor1aip1 A T 1: 156,007,562 M180K probably damaging Het
Unc79 A T 12: 103,134,478 T1858S probably damaging Het
Vmn1r193 T C 13: 22,219,391 T144A probably benign Het
Vwa8 T C 14: 79,081,136 F1046S probably benign Het
Wdr26 A T 1: 181,191,775 W346R probably damaging Het
Zfp740 T A 15: 102,207,901 V22E probably damaging Het
Zw10 C A 9: 49,069,741 S480R probably damaging Het
Other mutations in Trps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Trps1 APN 15 50846870 missense probably benign 0.07
IGL00497:Trps1 APN 15 50661307 missense possibly damaging 0.91
IGL00558:Trps1 APN 15 50661085 missense probably damaging 1.00
IGL01325:Trps1 APN 15 50846814 missense probably benign 0.40
IGL02132:Trps1 APN 15 50822278 missense probably damaging 1.00
IGL02631:Trps1 APN 15 50846021 missense probably damaging 1.00
IGL02740:Trps1 APN 15 50846539 missense probably damaging 1.00
IGL02821:Trps1 APN 15 50660877 missense probably damaging 1.00
IGL03096:Trps1 APN 15 50846479 missense probably benign
F5770:Trps1 UTSW 15 50831577 missense probably damaging 1.00
R0050:Trps1 UTSW 15 50765525 missense probably benign 0.18
R0244:Trps1 UTSW 15 50664743 missense probably damaging 1.00
R0377:Trps1 UTSW 15 50831778 nonsense probably null
R0599:Trps1 UTSW 15 50831860 nonsense probably null
R0848:Trps1 UTSW 15 50661549 missense possibly damaging 0.54
R1744:Trps1 UTSW 15 50661213 missense probably damaging 1.00
R2083:Trps1 UTSW 15 50822305 missense probably damaging 1.00
R2167:Trps1 UTSW 15 50831730 missense possibly damaging 0.94
R2267:Trps1 UTSW 15 50822398 missense probably damaging 1.00
R2314:Trps1 UTSW 15 50661346 missense probably damaging 1.00
R3735:Trps1 UTSW 15 50846060 missense possibly damaging 0.94
R4133:Trps1 UTSW 15 50831387 missense probably damaging 1.00
R4223:Trps1 UTSW 15 50846648 missense probably benign
R4280:Trps1 UTSW 15 50846082 missense probably benign 0.00
R4566:Trps1 UTSW 15 50831678 missense probably damaging 1.00
R4810:Trps1 UTSW 15 50822296 missense probably benign 0.14
R4828:Trps1 UTSW 15 50660677 makesense probably null
R4838:Trps1 UTSW 15 50827316 missense probably benign 0.05
R4852:Trps1 UTSW 15 50846309 missense probably damaging 1.00
R5001:Trps1 UTSW 15 50661307 missense possibly damaging 0.91
R5311:Trps1 UTSW 15 50664760 missense probably damaging 1.00
R5463:Trps1 UTSW 15 50831890 nonsense probably null
R5677:Trps1 UTSW 15 50846108 missense probably damaging 1.00
R5691:Trps1 UTSW 15 50827304 missense probably benign
R6432:Trps1 UTSW 15 50831397 missense probably damaging 0.96
R6528:Trps1 UTSW 15 50822427 missense probably benign 0.01
R6594:Trps1 UTSW 15 50830955 missense probably damaging 0.99
R6827:Trps1 UTSW 15 50822563 missense probably benign 0.14
R6862:Trps1 UTSW 15 50831605 critical splice donor site probably null
R6912:Trps1 UTSW 15 50822298 missense possibly damaging 0.92
R7151:Trps1 UTSW 15 50822397 missense possibly damaging 0.95
R7846:Trps1 UTSW 15 50831877 missense probably damaging 0.99
R7857:Trps1 UTSW 15 50661005 missense probably damaging 1.00
V7580:Trps1 UTSW 15 50831577 missense probably damaging 1.00
V7581:Trps1 UTSW 15 50831577 missense probably damaging 1.00
V7583:Trps1 UTSW 15 50831577 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTTCTCCTTGGAGGCACC -3'
(R):5'- CCTCAGGAAAGTACTGGAGATCC -3'

Sequencing Primer
(F):5'- ACCATTTGCAGTTGGCCCAG -3'
(R):5'- TCATCCGTATCTGATGGGAAAG -3'
Posted On2014-06-23