Incidental Mutation 'R1831:Dcst1'
ID207303
Institutional Source Beutler Lab
Gene Symbol Dcst1
Ensembl Gene ENSMUSG00000042672
Gene NameDC-STAMP domain containing 1
Synonyms
MMRRC Submission 039858-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R1831 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location89350219-89365253 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89352750 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 596 (F596L)
Ref Sequence ENSEMBL: ENSMUSP00000065502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029676] [ENSMUST00000070820] [ENSMUST00000074582] [ENSMUST00000107446] [ENSMUST00000107448] [ENSMUST00000184651]
Predicted Effect probably benign
Transcript: ENSMUST00000029676
SMART Domains Protein: ENSMUSP00000029676
Gene: ENSMUSG00000028041

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 29 158 1.2e-14 PFAM
Pfam:Reprolysin_3 208 360 1e-12 PFAM
Pfam:Reprolysin_5 212 394 1.5e-15 PFAM
Pfam:Reprolysin_4 214 410 3.1e-8 PFAM
Pfam:Reprolysin 214 416 1.6e-54 PFAM
Pfam:Reprolysin_2 257 405 9.9e-12 PFAM
DISIN 431 507 2.28e-37 SMART
ACR 508 650 8.38e-56 SMART
EGF 657 686 7.02e-1 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 763 781 N/A INTRINSIC
low complexity region 808 862 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000070820
AA Change: F596L

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000065502
Gene: ENSMUSG00000042672
AA Change: F596L

DomainStartEndE-ValueType
coiled coil region 18 44 N/A INTRINSIC
transmembrane domain 74 96 N/A INTRINSIC
transmembrane domain 108 125 N/A INTRINSIC
transmembrane domain 398 420 N/A INTRINSIC
Pfam:DC_STAMP 431 621 1.5e-55 PFAM
Blast:RING 672 710 3e-17 BLAST
SCOP:d1ldjb_ 672 710 2e-3 SMART
low complexity region 717 728 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074582
SMART Domains Protein: ENSMUSP00000074167
Gene: ENSMUSG00000028041

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 164 2.6e-21 PFAM
Pfam:Reprolysin_5 212 394 1.6e-15 PFAM
Pfam:Reprolysin_4 214 410 2.9e-8 PFAM
Pfam:Reprolysin 214 415 4.2e-56 PFAM
Pfam:Reprolysin_3 238 360 1.7e-14 PFAM
Pfam:Reprolysin_2 254 405 1.1e-10 PFAM
DISIN 431 507 2.28e-37 SMART
ACR 508 650 8.38e-56 SMART
EGF 657 686 7.02e-1 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 760 813 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000098929
Predicted Effect probably benign
Transcript: ENSMUST00000107446
SMART Domains Protein: ENSMUSP00000103070
Gene: ENSMUSG00000028041

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 164 9.9e-22 PFAM
Pfam:Reprolysin_3 209 360 5.9e-15 PFAM
Pfam:Reprolysin_5 212 394 5e-16 PFAM
Pfam:Reprolysin_4 213 410 1e-8 PFAM
Pfam:Reprolysin 214 415 1.4e-56 PFAM
Pfam:Reprolysin_2 253 405 4e-11 PFAM
low complexity region 416 446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107448
SMART Domains Protein: ENSMUSP00000103072
Gene: ENSMUSG00000028041

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 164 2.7e-21 PFAM
Pfam:Reprolysin_5 212 394 1.6e-15 PFAM
Pfam:Reprolysin_4 214 410 3e-8 PFAM
Pfam:Reprolysin 214 415 4.4e-56 PFAM
Pfam:Reprolysin_3 238 360 1.8e-14 PFAM
Pfam:Reprolysin_2 254 405 1.2e-10 PFAM
DISIN 431 507 2.28e-37 SMART
ACR 508 650 8.38e-56 SMART
EGF 657 686 7.02e-1 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 783 837 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124766
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127766
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134839
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139467
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155295
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180791
Predicted Effect probably benign
Transcript: ENSMUST00000184651
SMART Domains Protein: ENSMUSP00000139147
Gene: ENSMUSG00000028041

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 164 2.9e-21 PFAM
Pfam:Reprolysin_5 212 394 1.7e-15 PFAM
Pfam:Reprolysin_4 214 410 3.1e-8 PFAM
Pfam:Reprolysin 214 415 4.6e-56 PFAM
Pfam:Reprolysin_3 238 360 1.9e-14 PFAM
Pfam:Reprolysin_2 255 405 1.2e-10 PFAM
DISIN 431 507 2.28e-37 SMART
ACR 508 650 8.38e-56 SMART
EGF 657 686 7.02e-1 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 763 781 N/A INTRINSIC
low complexity region 808 862 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200174
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a transmembrane protein. A similar gene in human has been associated with dendritic cells. [provided by RefSeq, May 2015]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700109H08Rik A G 5: 3,577,255 D77G probably damaging Het
Adam1b A G 5: 121,502,937 I15T possibly damaging Het
Arfgef1 G C 1: 10,204,890 I312M probably benign Het
Capn8 G A 1: 182,611,101 probably null Het
Carmil1 A T 13: 24,164,879 V15E probably benign Het
Ccdc42 T A 11: 68,590,979 M133K probably benign Het
Cd5 T C 19: 10,719,569 D485G probably damaging Het
Cep104 T A 4: 154,002,546 V842E probably benign Het
Cep162 T A 9: 87,206,932 I966L probably damaging Het
Cklf T C 8: 104,251,055 F13S probably damaging Het
Csf2rb C T 15: 78,348,253 P587S probably benign Het
Cyp21a1 A T 17: 34,804,035 probably benign Het
Cyp26a1 A T 19: 37,700,623 L335F probably damaging Het
Dennd6a T A 14: 26,606,954 L44H probably damaging Het
Dnah6 G A 6: 73,181,797 R608C possibly damaging Het
Dnajb5 A T 4: 42,957,333 T311S probably benign Het
Dthd1 A G 5: 62,827,229 T426A probably benign Het
Dync1h1 A G 12: 110,614,059 K118R probably damaging Het
Efemp1 A T 11: 28,921,442 D347V possibly damaging Het
Ephb4 T A 5: 137,354,415 Y87N probably damaging Het
Ern1 A T 11: 106,399,842 probably null Het
Fam184a A T 10: 53,647,084 D164E probably damaging Het
Fkbp10 A G 11: 100,423,219 E351G probably damaging Het
Fmn2 A G 1: 174,609,945 S1161G probably benign Het
Frem1 A G 4: 83,020,837 S3P possibly damaging Het
Gm10260 A G 13: 97,760,545 V15A probably benign Het
Gm281 A G 14: 13,899,619 I101T probably damaging Het
Gpr3 C T 4: 133,211,143 A73T possibly damaging Het
Gprc6a T C 10: 51,615,806 T616A probably benign Het
Gtf3c2 G T 5: 31,168,369 Q452K probably damaging Het
H2-Q7 C A 17: 35,439,699 S104R probably benign Het
Hacd2 T C 16: 35,102,064 Y208H probably damaging Het
Hid1 C T 11: 115,348,903 G734R probably damaging Het
Ifi207 A G 1: 173,732,426 I160T unknown Het
Itga11 T A 9: 62,782,018 L1155Q probably damaging Het
Kmt2d A G 15: 98,855,343 S157P probably damaging Het
Lamb3 A G 1: 193,334,879 T793A probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrrc66 G A 5: 73,607,426 S758L possibly damaging Het
Ltn1 C T 16: 87,400,146 S1213N possibly damaging Het
Med1 T C 11: 98,156,611 probably benign Het
Megf6 C T 4: 154,270,677 T1483M probably benign Het
Micall2 A G 5: 139,716,753 V245A probably benign Het
Mipep T G 14: 60,872,063 Y630D probably damaging Het
Ndst3 T A 3: 123,601,478 H501L probably benign Het
Nek10 A T 14: 14,842,789 M165L probably benign Het
Nmbr C A 10: 14,766,865 T56K probably benign Het
Nxpe2 T A 9: 48,326,152 M268L probably benign Het
Oasl2 A G 5: 114,901,306 Y185C probably benign Het
Ogdhl T A 14: 32,337,527 V377E probably damaging Het
Olfr115 G A 17: 37,609,839 S304L possibly damaging Het
Olfr738 T A 14: 50,414,201 probably null Het
Ovgp1 A G 3: 105,985,068 R346G probably benign Het
Parp14 T A 16: 35,858,588 N337Y possibly damaging Het
Pask A C 1: 93,320,769 probably null Het
Pax3 G T 1: 78,132,340 T227K probably damaging Het
Pik3r6 T A 11: 68,544,034 M594K probably benign Het
Pms1 A G 1: 53,207,211 F390L probably benign Het
Polg G A 7: 79,459,770 T433I probably benign Het
Prex1 T C 2: 166,585,101 Y898C probably damaging Het
Ranbp2 T A 10: 58,479,222 C1921* probably null Het
Rif1 T A 2: 52,078,495 L230* probably null Het
Rnf148 A G 6: 23,654,773 F75L probably damaging Het
Sclt1 A G 3: 41,727,111 V91A probably damaging Het
Sirt1 T C 10: 63,320,646 D735G probably benign Het
Spag5 T A 11: 78,314,256 N622K probably benign Het
Sspo T G 6: 48,489,786 C3935W probably damaging Het
Strbp A G 2: 37,625,265 S250P possibly damaging Het
Tgfbr2 T C 9: 116,090,536 T541A possibly damaging Het
Thada A C 17: 84,231,114 S1489A probably damaging Het
Tiam1 A T 16: 89,860,294 S685T probably benign Het
Tldc1 T C 8: 119,771,253 M171V probably null Het
Tpsb2 T A 17: 25,366,520 probably null Het
Trip4 C A 9: 65,858,340 G359V probably damaging Het
Tsr1 T C 11: 74,900,356 F254L probably benign Het
Vmn1r120 T C 7: 21,053,631 K52E probably benign Het
Vmn1r29 C A 6: 58,307,707 Y137* probably null Het
Vmn2r52 T C 7: 10,159,488 K575E probably damaging Het
Wdr95 A G 5: 149,552,426 Y63C probably damaging Het
Other mutations in Dcst1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02373:Dcst1 APN 3 89357891 missense probably damaging 0.98
R0722:Dcst1 UTSW 3 89353805 missense probably benign 0.04
R0782:Dcst1 UTSW 3 89357500 missense possibly damaging 0.88
R0891:Dcst1 UTSW 3 89353277 missense probably benign 0.16
R1434:Dcst1 UTSW 3 89352519 missense probably damaging 1.00
R1807:Dcst1 UTSW 3 89353541 missense probably damaging 1.00
R2129:Dcst1 UTSW 3 89357545 missense probably damaging 0.97
R2371:Dcst1 UTSW 3 89358642 missense possibly damaging 0.47
R4600:Dcst1 UTSW 3 89356336 missense probably benign 0.01
R4761:Dcst1 UTSW 3 89357553 missense possibly damaging 0.83
R4906:Dcst1 UTSW 3 89350507 missense possibly damaging 0.85
R4974:Dcst1 UTSW 3 89357803 missense probably benign 0.27
R5552:Dcst1 UTSW 3 89365066 missense probably benign 0.03
R5910:Dcst1 UTSW 3 89350424 missense possibly damaging 0.94
R5943:Dcst1 UTSW 3 89356411 splice site probably null
R5992:Dcst1 UTSW 3 89352576 missense probably damaging 1.00
R6630:Dcst1 UTSW 3 89364326 missense possibly damaging 0.75
R6685:Dcst1 UTSW 3 89356873 missense possibly damaging 0.49
R6877:Dcst1 UTSW 3 89350360 missense probably benign 0.06
R7592:Dcst1 UTSW 3 89353292 missense probably benign 0.06
R7805:Dcst1 UTSW 3 89352761 missense probably damaging 1.00
R7825:Dcst1 UTSW 3 89352821 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TTGTAGAAGAACAGAGCCCG -3'
(R):5'- AACTGGAAGTCCACCCTGTAC -3'

Sequencing Primer
(F):5'- GAACAGAGCCCGCTTCTTC -3'
(R):5'- GAAGTCCACCCTGTACCTCCAG -3'
Posted On2014-06-23