Mutagenetix > Incidental Mutations

Incidental Mutation 'R1831:Ndst3'

207305

Institutional Source

Beutler Lab

Gene Symbol

Ndst3

Ensembl Gene

ENSMUSG00000027977

Gene Name

N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3

Synonyms

4930511P15Rik, 4921531K01Rik

MMRRC Submission

039858-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.273) question?

Stock #

R1831 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

123526166-123690853 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 123601478 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 501 (H501L)

Ref Sequence

ENSEMBL: ENSMUSP00000133657 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029602] [ENSMUST00000124803] [ENSMUST00000132112] [ENSMUST00000137404] [ENSMUST00000154668] [ENSMUST00000172537]

Predicted Effect

probably benign
Transcript: ENSMUST00000029602
AA Change: H501L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000029602
Gene: ENSMUSG00000027977
AA Change: H501L

Domain	Start	End	E-Value	Type
Pfam:HSNSD	19	506	4.6e-272	PFAM
Pfam:Sulfotransfer_1	595	858	8.4e-44	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000124803
AA Change: H86L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000122617
Gene: ENSMUSG00000027977
AA Change: H86L

Domain	Start	End	E-Value	Type
Pfam:HSNSD	1	91	1.7e-62	PFAM
Pfam:Sulfotransfer_1	180	443	7.8e-44	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000132112
AA Change: H86L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000120623
Gene: ENSMUSG00000027977
AA Change: H86L

Domain	Start	End	E-Value	Type
Pfam:HSNSD	1	91	1.7e-62	PFAM
Pfam:Sulfotransfer_1	180	443	7.8e-44	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000137404
AA Change: H501L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000118796
Gene: ENSMUSG00000027977
AA Change: H501L

Domain	Start	End	E-Value	Type
Pfam:HSNSD	19	506	6.4e-272	PFAM
PDB:1NST\|A	549	637	2e-38	PDB
SCOP:d1nsta_	570	641	9e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000154668
AA Change: H501L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000118207
Gene: ENSMUSG00000027977
AA Change: H501L

Domain	Start	End	E-Value	Type
Pfam:HSNSD	20	506	1.7e-253	PFAM
Pfam:Sulfotransfer_1	595	858	8.4e-44	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000172537
AA Change: H501L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000133657
Gene: ENSMUSG00000027977
AA Change: H501L

Domain	Start	End	E-Value	Type
Pfam:HSNSD	20	328	2.4e-130	PFAM
Pfam:HSNSD	326	425	8.2e-62	PFAM
PDB:1NST\|A	468	556	7e-39	PDB
SCOP:d1nsta_	489	560	5e-17	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199046

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.2%
20x: 92.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heparan sulfate/heparin GlcNAc N-deacetylase/ N-sulfotransferase family. The encoded enzyme is a type II transmembrane protein that resides in the Golgi apparatus. This monomeric bifunctional enzyme catalyzes the N-deacetylation and N-sulfation of N-acetylglucosamine residues in heparan sulfate and heparin, which are the initial chemical modifications required for the biosynthesis of the functional oligosaccharide sequences that define the specific ligand binding activities of heparan sulfate and heparin. [provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a knockout allele exhibit decreased anxiety-related behavior, cholesterol levels and CD8+ T cells due to moderate heparan-sulfate undersulfation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700109H08Rik	A	G	5: 3,577,255	D77G	probably damaging	Het
Adam1b	A	G	5: 121,502,937	I15T	possibly damaging	Het
Arfgef1	G	C	1: 10,204,890	I312M	probably benign	Het
Capn8	G	A	1: 182,611,101		probably null	Het
Carmil1	A	T	13: 24,164,879	V15E	probably benign	Het
Ccdc42	T	A	11: 68,590,979	M133K	probably benign	Het
Cd5	T	C	19: 10,719,569	D485G	probably damaging	Het
Cep104	T	A	4: 154,002,546	V842E	probably benign	Het
Cep162	T	A	9: 87,206,932	I966L	probably damaging	Het
Cklf	T	C	8: 104,251,055	F13S	probably damaging	Het
Csf2rb	C	T	15: 78,348,253	P587S	probably benign	Het
Cyp21a1	A	T	17: 34,804,035		probably benign	Het
Cyp26a1	A	T	19: 37,700,623	L335F	probably damaging	Het
Dcst1	A	G	3: 89,352,750	F596L	probably damaging	Het
Dennd6a	T	A	14: 26,606,954	L44H	probably damaging	Het
Dnah6	G	A	6: 73,181,797	R608C	possibly damaging	Het
Dnajb5	A	T	4: 42,957,333	T311S	probably benign	Het
Dthd1	A	G	5: 62,827,229	T426A	probably benign	Het
Dync1h1	A	G	12: 110,614,059	K118R	probably damaging	Het
Efemp1	A	T	11: 28,921,442	D347V	possibly damaging	Het
Ephb4	T	A	5: 137,354,415	Y87N	probably damaging	Het
Ern1	A	T	11: 106,399,842		probably null	Het
Fam184a	A	T	10: 53,647,084	D164E	probably damaging	Het
Fkbp10	A	G	11: 100,423,219	E351G	probably damaging	Het
Fmn2	A	G	1: 174,609,945	S1161G	probably benign	Het
Frem1	A	G	4: 83,020,837	S3P	possibly damaging	Het
Gm10260	A	G	13: 97,760,545	V15A	probably benign	Het
Gm281	A	G	14: 13,899,619	I101T	probably damaging	Het
Gpr3	C	T	4: 133,211,143	A73T	possibly damaging	Het
Gprc6a	T	C	10: 51,615,806	T616A	probably benign	Het
Gtf3c2	G	T	5: 31,168,369	Q452K	probably damaging	Het
H2-Q7	C	A	17: 35,439,699	S104R	probably benign	Het
Hacd2	T	C	16: 35,102,064	Y208H	probably damaging	Het
Hid1	C	T	11: 115,348,903	G734R	probably damaging	Het
Ifi207	A	G	1: 173,732,426	I160T	unknown	Het
Itga11	T	A	9: 62,782,018	L1155Q	probably damaging	Het
Kmt2d	A	G	15: 98,855,343	S157P	probably damaging	Het
Lamb3	A	G	1: 193,334,879	T793A	probably damaging	Het
Lonrf2	G	A	1: 38,813,276	P165S	probably benign	Het
Lrrc66	G	A	5: 73,607,426	S758L	possibly damaging	Het
Ltn1	C	T	16: 87,400,146	S1213N	possibly damaging	Het
Med1	T	C	11: 98,156,611		probably benign	Het
Megf6	C	T	4: 154,270,677	T1483M	probably benign	Het
Micall2	A	G	5: 139,716,753	V245A	probably benign	Het
Mipep	T	G	14: 60,872,063	Y630D	probably damaging	Het
Nek10	A	T	14: 14,842,789	M165L	probably benign	Het
Nmbr	C	A	10: 14,766,865	T56K	probably benign	Het
Nxpe2	T	A	9: 48,326,152	M268L	probably benign	Het
Oasl2	A	G	5: 114,901,306	Y185C	probably benign	Het
Ogdhl	T	A	14: 32,337,527	V377E	probably damaging	Het
Olfr115	G	A	17: 37,609,839	S304L	possibly damaging	Het
Olfr738	T	A	14: 50,414,201		probably null	Het
Ovgp1	A	G	3: 105,985,068	R346G	probably benign	Het
Parp14	T	A	16: 35,858,588	N337Y	possibly damaging	Het
Pask	A	C	1: 93,320,769		probably null	Het
Pax3	G	T	1: 78,132,340	T227K	probably damaging	Het
Pik3r6	T	A	11: 68,544,034	M594K	probably benign	Het
Pms1	A	G	1: 53,207,211	F390L	probably benign	Het
Polg	G	A	7: 79,459,770	T433I	probably benign	Het
Prex1	T	C	2: 166,585,101	Y898C	probably damaging	Het
Ranbp2	T	A	10: 58,479,222	C1921*	probably null	Het
Rif1	T	A	2: 52,078,495	L230*	probably null	Het
Rnf148	A	G	6: 23,654,773	F75L	probably damaging	Het
Sclt1	A	G	3: 41,727,111	V91A	probably damaging	Het
Sirt1	T	C	10: 63,320,646	D735G	probably benign	Het
Spag5	T	A	11: 78,314,256	N622K	probably benign	Het
Sspo	T	G	6: 48,489,786	C3935W	probably damaging	Het
Strbp	A	G	2: 37,625,265	S250P	possibly damaging	Het
Tgfbr2	T	C	9: 116,090,536	T541A	possibly damaging	Het
Thada	A	C	17: 84,231,114	S1489A	probably damaging	Het
Tiam1	A	T	16: 89,860,294	S685T	probably benign	Het
Tldc1	T	C	8: 119,771,253	M171V	probably null	Het
Tpsb2	T	A	17: 25,366,520		probably null	Het
Trip4	C	A	9: 65,858,340	G359V	probably damaging	Het
Tsr1	T	C	11: 74,900,356	F254L	probably benign	Het
Vmn1r120	T	C	7: 21,053,631	K52E	probably benign	Het
Vmn1r29	C	A	6: 58,307,707	Y137*	probably null	Het
Vmn2r52	T	C	7: 10,159,488	K575E	probably damaging	Het
Wdr95	A	G	5: 149,552,426	Y63C	probably damaging	Het

Other mutations in Ndst3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00505:Ndst3	APN	3	123627950	splice site	probably benign
IGL00543:Ndst3	APN	3	123672263	missense	probably damaging	0.99
IGL01067:Ndst3	APN	3	123546817	missense	probably damaging	1.00
IGL01301:Ndst3	APN	3	123548916	missense	probably damaging	0.97
IGL01975:Ndst3	APN	3	123601514	missense	possibly damaging	0.67
IGL02376:Ndst3	APN	3	123556798	missense	probably damaging	0.98
IGL02715:Ndst3	APN	3	123546761	splice site	probably benign
IGL03111:Ndst3	APN	3	123672096	missense	possibly damaging	0.96
Jack_sprat	UTSW	3	123552552	missense	probably damaging	0.99
ANU18:Ndst3	UTSW	3	123548916	missense	probably damaging	0.97
R0027:Ndst3	UTSW	3	123671513	missense	probably damaging	1.00
R0288:Ndst3	UTSW	3	123672194	missense	probably benign	0.03
R0630:Ndst3	UTSW	3	123562071	missense	probably damaging	0.98
R1168:Ndst3	UTSW	3	123606968	missense	probably benign	0.22
R1400:Ndst3	UTSW	3	123556828	missense	probably damaging	1.00
R1513:Ndst3	UTSW	3	123601455	missense	possibly damaging	0.75
R1524:Ndst3	UTSW	3	123548906	missense	possibly damaging	0.94
R1830:Ndst3	UTSW	3	123548938	missense	probably damaging	0.96
R1865:Ndst3	UTSW	3	123671471	missense	probably damaging	1.00
R1871:Ndst3	UTSW	3	123562024	missense	probably damaging	1.00
R2041:Ndst3	UTSW	3	123672215	missense	probably benign	0.01
R2056:Ndst3	UTSW	3	123671885	missense	probably damaging	0.98
R2362:Ndst3	UTSW	3	123552678	missense	possibly damaging	0.94
R2484:Ndst3	UTSW	3	123552537	missense	possibly damaging	0.83
R3747:Ndst3	UTSW	3	123671552	missense	probably benign	0.09
R4152:Ndst3	UTSW	3	123672227	missense	probably damaging	1.00
R4153:Ndst3	UTSW	3	123672227	missense	probably damaging	1.00
R4154:Ndst3	UTSW	3	123672227	missense	probably damaging	1.00
R4512:Ndst3	UTSW	3	123671666	missense	probably damaging	1.00
R4579:Ndst3	UTSW	3	123546825	missense	probably benign	0.00
R4611:Ndst3	UTSW	3	123671549	missense	probably benign	0.35
R4646:Ndst3	UTSW	3	123672035	missense	probably damaging	0.96
R4718:Ndst3	UTSW	3	123672266	missense	probably benign	0.35
R4944:Ndst3	UTSW	3	123607027	missense	probably damaging	0.99
R4945:Ndst3	UTSW	3	123552552	missense	probably damaging	1.00
R5179:Ndst3	UTSW	3	123552532	missense	probably damaging	0.97
R5232:Ndst3	UTSW	3	123672239	missense	probably damaging	0.99
R5421:Ndst3	UTSW	3	123634359	intron	probably null
R5874:Ndst3	UTSW	3	123561907	missense	probably damaging	1.00
R6030:Ndst3	UTSW	3	123552519	missense	probably damaging	1.00
R6030:Ndst3	UTSW	3	123552519	missense	probably damaging	1.00
R6228:Ndst3	UTSW	3	123671652	nonsense	probably null
R6496:Ndst3	UTSW	3	123552552	missense	probably damaging	0.99
R6562:Ndst3	UTSW	3	123552532	missense	probably damaging	0.97
R7045:Ndst3	UTSW	3	123672083	missense	probably damaging	0.96
R7152:Ndst3	UTSW	3	123552656	missense	possibly damaging	0.66
R7202:Ndst3	UTSW	3	123671739	missense	possibly damaging	0.94
R7239:Ndst3	UTSW	3	123606906	missense	probably damaging	1.00
R7305:Ndst3	UTSW	3	123601482	missense	possibly damaging	0.62
R7417:Ndst3	UTSW	3	123671664	missense	probably damaging	1.00
R7469:Ndst3	UTSW	3	123671661	missense	possibly damaging	0.82
R7553:Ndst3	UTSW	3	123557060	intron	probably null
R8065:Ndst3	UTSW	3	123601445	missense	probably damaging	1.00
R8067:Ndst3	UTSW	3	123601445	missense	probably damaging	1.00
Z1176:Ndst3	UTSW	3	123552630	missense	probably damaging	1.00
Z1176:Ndst3	UTSW	3	123627969	missense	possibly damaging	0.49
Z1176:Ndst3	UTSW	3	123671494	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATTCTCCATGGACACGATGTC -3'
(R):5'- GCCACTTGCTAGTAACACCATG -3'

Sequencing Primer
(F):5'- ACACGATGTCCATGCTGTTTG -3'
(R):5'- CCTGGTTATCGTTCAATAAATGCC -3'

Posted On

2014-06-23