Incidental Mutation 'R1831:Megf6'
ID207310
Institutional Source Beutler Lab
Gene Symbol Megf6
Ensembl Gene ENSMUSG00000057751
Gene Namemultiple EGF-like-domains 6
Synonyms2600001P17Rik, Egfl3
MMRRC Submission 039858-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1831 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location154170730-154275713 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 154270677 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 1483 (T1483M)
Ref Sequence ENSEMBL: ENSMUSP00000030897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030897] [ENSMUST00000152159]
Predicted Effect probably benign
Transcript: ENSMUST00000030897
AA Change: T1483M

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000030897
Gene: ENSMUSG00000057751
AA Change: T1483M

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
EGF_CA 122 162 1.54e-6 SMART
EGF_CA 163 203 2.08e-12 SMART
EGF 207 245 5.4e-2 SMART
EGF 249 286 2.39e-3 SMART
EGF_CA 287 327 4.96e-10 SMART
EGF 336 373 1.64e-1 SMART
EGF 377 413 1.99e1 SMART
EGF_CA 414 454 7.4e-9 SMART
EGF 521 554 4.26e0 SMART
EGF_Lam 570 609 1.19e-3 SMART
EGF_like 613 652 5.29e-1 SMART
EGF 642 685 2.2e1 SMART
EGF_Lam 656 697 1.04e-3 SMART
EGF 687 730 1.59e1 SMART
EGF_like 701 742 2.27e0 SMART
EGF_Lam 746 784 1.33e-1 SMART
EGF 783 816 2.85e-1 SMART
EGF_Lam 832 871 3.88e-3 SMART
EGF_Lam 875 915 3.25e-5 SMART
EGF 914 946 4.7e-2 SMART
EGF_like 962 1001 1.69e-1 SMART
EGF 1000 1032 7.02e-1 SMART
EGF_Lam 1048 1087 3.1e-2 SMART
EGF 1077 1118 7.53e-1 SMART
EGF_like 1091 1130 5.59e-1 SMART
EGF 1129 1161 5.04e-2 SMART
EGF_Lam 1177 1216 2.94e-3 SMART
EGF 1206 1248 1.87e1 SMART
EGF_Lam 1220 1260 3.1e-2 SMART
EGF 1259 1291 1.73e0 SMART
EGF 1302 1334 6.55e-1 SMART
EGF 1345 1377 4.39e-2 SMART
EGF_Lam 1393 1432 7.64e-2 SMART
EGF_Lam 1436 1475 2.64e-5 SMART
EGF_like 1465 1506 4.2e1 SMART
EGF_Lam 1479 1518 1.19e-3 SMART
EGF 1517 1549 1.84e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127088
Predicted Effect probably benign
Transcript: ENSMUST00000128700
SMART Domains Protein: ENSMUSP00000117277
Gene: ENSMUSG00000057751

DomainStartEndE-ValueType
EGF_Lam 3 42 3.1e-2 SMART
EGF 32 73 7.53e-1 SMART
EGF_like 46 85 8.92e-1 SMART
EGF 84 116 7.13e-2 SMART
EGF 127 159 1.73e0 SMART
EGF 170 202 6.55e-1 SMART
EGF 213 245 4.39e-2 SMART
EGF_Lam 261 300 7.64e-2 SMART
EGF 299 331 1.51e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138945
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142110
Predicted Effect probably benign
Transcript: ENSMUST00000152159
SMART Domains Protein: ENSMUSP00000121641
Gene: ENSMUSG00000057751

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF_CA 55 95 2.08e-12 SMART
EGF 99 137 5.4e-2 SMART
EGF 141 178 2.39e-3 SMART
EGF_CA 179 219 4.96e-10 SMART
EGF 228 265 1.64e-1 SMART
EGF 269 305 1.99e1 SMART
EGF_CA 306 346 7.4e-9 SMART
EGF 413 446 4.26e0 SMART
EGF_Lam 462 501 1.19e-3 SMART
EGF_like 505 544 5.29e-1 SMART
EGF 534 577 2.2e1 SMART
EGF_Lam 548 589 1.04e-3 SMART
EGF 579 622 1.59e1 SMART
EGF_like 593 634 2.27e0 SMART
EGF_Lam 638 676 1.33e-1 SMART
EGF 675 708 2.85e-1 SMART
EGF_Lam 724 763 3.88e-3 SMART
EGF_Lam 767 807 3.25e-5 SMART
EGF 806 838 4.7e-2 SMART
EGF_Lam 854 893 2.56e-3 SMART
EGF 892 924 2.02e-1 SMART
EGF 935 967 7.13e-2 SMART
EGF 978 1010 1.73e0 SMART
EGF 1021 1053 6.55e-1 SMART
EGF 1064 1096 4.39e-2 SMART
EGF 1107 1139 4.97e-1 SMART
EGF 1159 1191 1.84e1 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700109H08Rik A G 5: 3,577,255 D77G probably damaging Het
Adam1b A G 5: 121,502,937 I15T possibly damaging Het
Arfgef1 G C 1: 10,204,890 I312M probably benign Het
Capn8 G A 1: 182,611,101 probably null Het
Carmil1 A T 13: 24,164,879 V15E probably benign Het
Ccdc42 T A 11: 68,590,979 M133K probably benign Het
Cd5 T C 19: 10,719,569 D485G probably damaging Het
Cep104 T A 4: 154,002,546 V842E probably benign Het
Cep162 T A 9: 87,206,932 I966L probably damaging Het
Cklf T C 8: 104,251,055 F13S probably damaging Het
Csf2rb C T 15: 78,348,253 P587S probably benign Het
Cyp21a1 A T 17: 34,804,035 probably benign Het
Cyp26a1 A T 19: 37,700,623 L335F probably damaging Het
Dcst1 A G 3: 89,352,750 F596L probably damaging Het
Dennd6a T A 14: 26,606,954 L44H probably damaging Het
Dnah6 G A 6: 73,181,797 R608C possibly damaging Het
Dnajb5 A T 4: 42,957,333 T311S probably benign Het
Dthd1 A G 5: 62,827,229 T426A probably benign Het
Dync1h1 A G 12: 110,614,059 K118R probably damaging Het
Efemp1 A T 11: 28,921,442 D347V possibly damaging Het
Ephb4 T A 5: 137,354,415 Y87N probably damaging Het
Ern1 A T 11: 106,399,842 probably null Het
Fam184a A T 10: 53,647,084 D164E probably damaging Het
Fkbp10 A G 11: 100,423,219 E351G probably damaging Het
Fmn2 A G 1: 174,609,945 S1161G probably benign Het
Frem1 A G 4: 83,020,837 S3P possibly damaging Het
Gm10260 A G 13: 97,760,545 V15A probably benign Het
Gm281 A G 14: 13,899,619 I101T probably damaging Het
Gpr3 C T 4: 133,211,143 A73T possibly damaging Het
Gprc6a T C 10: 51,615,806 T616A probably benign Het
Gtf3c2 G T 5: 31,168,369 Q452K probably damaging Het
H2-Q7 C A 17: 35,439,699 S104R probably benign Het
Hacd2 T C 16: 35,102,064 Y208H probably damaging Het
Hid1 C T 11: 115,348,903 G734R probably damaging Het
Ifi207 A G 1: 173,732,426 I160T unknown Het
Itga11 T A 9: 62,782,018 L1155Q probably damaging Het
Kmt2d A G 15: 98,855,343 S157P probably damaging Het
Lamb3 A G 1: 193,334,879 T793A probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrrc66 G A 5: 73,607,426 S758L possibly damaging Het
Ltn1 C T 16: 87,400,146 S1213N possibly damaging Het
Med1 T C 11: 98,156,611 probably benign Het
Micall2 A G 5: 139,716,753 V245A probably benign Het
Mipep T G 14: 60,872,063 Y630D probably damaging Het
Ndst3 T A 3: 123,601,478 H501L probably benign Het
Nek10 A T 14: 14,842,789 M165L probably benign Het
Nmbr C A 10: 14,766,865 T56K probably benign Het
Nxpe2 T A 9: 48,326,152 M268L probably benign Het
Oasl2 A G 5: 114,901,306 Y185C probably benign Het
Ogdhl T A 14: 32,337,527 V377E probably damaging Het
Olfr115 G A 17: 37,609,839 S304L possibly damaging Het
Olfr738 T A 14: 50,414,201 probably null Het
Ovgp1 A G 3: 105,985,068 R346G probably benign Het
Parp14 T A 16: 35,858,588 N337Y possibly damaging Het
Pask A C 1: 93,320,769 probably null Het
Pax3 G T 1: 78,132,340 T227K probably damaging Het
Pik3r6 T A 11: 68,544,034 M594K probably benign Het
Pms1 A G 1: 53,207,211 F390L probably benign Het
Polg G A 7: 79,459,770 T433I probably benign Het
Prex1 T C 2: 166,585,101 Y898C probably damaging Het
Ranbp2 T A 10: 58,479,222 C1921* probably null Het
Rif1 T A 2: 52,078,495 L230* probably null Het
Rnf148 A G 6: 23,654,773 F75L probably damaging Het
Sclt1 A G 3: 41,727,111 V91A probably damaging Het
Sirt1 T C 10: 63,320,646 D735G probably benign Het
Spag5 T A 11: 78,314,256 N622K probably benign Het
Sspo T G 6: 48,489,786 C3935W probably damaging Het
Strbp A G 2: 37,625,265 S250P possibly damaging Het
Tgfbr2 T C 9: 116,090,536 T541A possibly damaging Het
Thada A C 17: 84,231,114 S1489A probably damaging Het
Tiam1 A T 16: 89,860,294 S685T probably benign Het
Tldc1 T C 8: 119,771,253 M171V probably null Het
Tpsb2 T A 17: 25,366,520 probably null Het
Trip4 C A 9: 65,858,340 G359V probably damaging Het
Tsr1 T C 11: 74,900,356 F254L probably benign Het
Vmn1r120 T C 7: 21,053,631 K52E probably benign Het
Vmn1r29 C A 6: 58,307,707 Y137* probably null Het
Vmn2r52 T C 7: 10,159,488 K575E probably damaging Het
Wdr95 A G 5: 149,552,426 Y63C probably damaging Het
Other mutations in Megf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Megf6 APN 4 154253807 missense probably damaging 1.00
IGL01410:Megf6 APN 4 154252563 critical splice donor site probably null
IGL01512:Megf6 APN 4 154262583 missense possibly damaging 0.64
IGL01824:Megf6 APN 4 154252234 missense probably damaging 1.00
IGL02172:Megf6 APN 4 154270692 missense probably damaging 1.00
IGL02727:Megf6 APN 4 154253149 splice site probably null
IGL02966:Megf6 APN 4 154253777 missense probably damaging 1.00
Didactic UTSW 4 154254587 missense probably damaging 1.00
R0118:Megf6 UTSW 4 154254641 missense probably damaging 0.99
R0220:Megf6 UTSW 4 154258215 missense probably damaging 1.00
R0347:Megf6 UTSW 4 154254635 missense possibly damaging 0.90
R0383:Megf6 UTSW 4 154265326 missense probably benign 0.01
R0417:Megf6 UTSW 4 154267967 missense probably benign 0.06
R0526:Megf6 UTSW 4 154258941 missense probably benign
R0528:Megf6 UTSW 4 154259173 missense probably benign 0.04
R0928:Megf6 UTSW 4 154177047 missense probably damaging 1.00
R1311:Megf6 UTSW 4 154263782 splice site probably null
R1458:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1470:Megf6 UTSW 4 154252419 splice site probably benign
R1476:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1479:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1624:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1626:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1638:Megf6 UTSW 4 154262510 splice site probably benign
R1777:Megf6 UTSW 4 154270690 nonsense probably null
R1944:Megf6 UTSW 4 154256066 missense possibly damaging 0.75
R1984:Megf6 UTSW 4 154267667 missense probably damaging 1.00
R2109:Megf6 UTSW 4 154177121 missense probably benign 0.39
R2448:Megf6 UTSW 4 154266645 intron probably null
R2880:Megf6 UTSW 4 154252549 missense probably damaging 1.00
R4032:Megf6 UTSW 4 154177093 nonsense probably null
R4058:Megf6 UTSW 4 154242532 splice site probably benign
R4672:Megf6 UTSW 4 154249452 missense probably damaging 0.99
R4688:Megf6 UTSW 4 154253814 missense probably damaging 0.99
R4752:Megf6 UTSW 4 154252438 missense probably damaging 1.00
R4863:Megf6 UTSW 4 154254281 critical splice donor site probably null
R4909:Megf6 UTSW 4 154265391 missense probably damaging 1.00
R4942:Megf6 UTSW 4 154253820 missense probably damaging 1.00
R4981:Megf6 UTSW 4 154267450 missense possibly damaging 0.95
R4990:Megf6 UTSW 4 154267226 missense possibly damaging 0.94
R5001:Megf6 UTSW 4 154268060 missense probably damaging 1.00
R5189:Megf6 UTSW 4 154252523 missense probably benign 0.31
R5210:Megf6 UTSW 4 154269816 intron probably benign
R5220:Megf6 UTSW 4 154253838 critical splice donor site probably null
R5250:Megf6 UTSW 4 154256010 missense possibly damaging 0.65
R5697:Megf6 UTSW 4 154258229 missense probably null 0.15
R5808:Megf6 UTSW 4 154267662 missense probably benign
R5916:Megf6 UTSW 4 154249425 critical splice acceptor site probably null
R6054:Megf6 UTSW 4 154263179 missense probably benign 0.06
R6075:Megf6 UTSW 4 154262599 nonsense probably null
R6515:Megf6 UTSW 4 154258919 missense possibly damaging 0.84
R6599:Megf6 UTSW 4 154258087 splice site probably null
R6811:Megf6 UTSW 4 154252161 missense probably damaging 1.00
R6925:Megf6 UTSW 4 154254587 missense probably damaging 1.00
R7023:Megf6 UTSW 4 154254145 missense possibly damaging 0.95
R7117:Megf6 UTSW 4 154258922 missense possibly damaging 0.78
R7163:Megf6 UTSW 4 154267441 missense probably damaging 0.98
R7345:Megf6 UTSW 4 154267315 missense probably benign
R7580:Megf6 UTSW 4 154270744 nonsense probably null
R7649:Megf6 UTSW 4 154265085 missense probably damaging 0.96
R7702:Megf6 UTSW 4 154270470 missense probably benign 0.00
R8010:Megf6 UTSW 4 154270507 missense probably benign 0.13
Z1177:Megf6 UTSW 4 154237826 missense probably benign 0.12
Z1177:Megf6 UTSW 4 154250849 missense probably damaging 1.00
Z1177:Megf6 UTSW 4 154267681 missense possibly damaging 0.48
Z1177:Megf6 UTSW 4 154267682 missense probably damaging 0.99
Z1177:Megf6 UTSW 4 154267747 nonsense probably null
Z1177:Megf6 UTSW 4 154269741 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTGCGAGTGTCAACAGGGC -3'
(R):5'- AGCTCCGATGGATGTCTATGC -3'

Sequencing Primer
(F):5'- TGTGACCCTGTCAGTGGC -3'
(R):5'- GCACAGTGCCTAGTCTGAG -3'
Posted On2014-06-23