Incidental Mutation 'R1831:Adam1b'
ID207317
Institutional Source Beutler Lab
Gene Symbol Adam1b
Ensembl Gene ENSMUSG00000062438
Gene Namea disintegrin and metallopeptidase domain 1b
SynonymsPH-30 alpha, Ftna, fertilin alpha
MMRRC Submission 039858-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1831 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location121500098-121503435 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121502937 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 15 (I15T)
Ref Sequence ENSEMBL: ENSMUSP00000078343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079368] [ENSMUST00000111795] [ENSMUST00000156080]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079368
AA Change: I15T

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000078343
Gene: ENSMUSG00000062438
AA Change: I15T

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:Pep_M12B_propep 38 159 1.6e-18 PFAM
Pfam:Reprolysin_5 201 378 2.9e-15 PFAM
Pfam:Reprolysin_4 202 386 6.8e-9 PFAM
Pfam:Reprolysin 203 397 2.4e-70 PFAM
Pfam:Reprolysin_3 223 349 3.9e-14 PFAM
Pfam:Reprolysin_2 223 387 5.8e-9 PFAM
DISIN 415 488 8.08e-29 SMART
ACR 489 628 3.41e-47 SMART
EGF 634 665 2.34e1 SMART
transmembrane domain 705 727 N/A INTRINSIC
coiled coil region 763 801 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111795
SMART Domains Protein: ENSMUSP00000144614
Gene: ENSMUSG00000029452

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156080
SMART Domains Protein: ENSMUSP00000121579
Gene: ENSMUSG00000029452

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
transmembrane domain 94 116 N/A INTRINSIC
transmembrane domain 140 162 N/A INTRINSIC
transmembrane domain 205 227 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196484
Meta Mutation Damage Score 0.062 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable, healthy and fertile with no significant defects in sperm function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700109H08Rik A G 5: 3,577,255 D77G probably damaging Het
Arfgef1 G C 1: 10,204,890 I312M probably benign Het
Capn8 G A 1: 182,611,101 probably null Het
Carmil1 A T 13: 24,164,879 V15E probably benign Het
Ccdc42 T A 11: 68,590,979 M133K probably benign Het
Cd5 T C 19: 10,719,569 D485G probably damaging Het
Cep104 T A 4: 154,002,546 V842E probably benign Het
Cep162 T A 9: 87,206,932 I966L probably damaging Het
Cklf T C 8: 104,251,055 F13S probably damaging Het
Csf2rb C T 15: 78,348,253 P587S probably benign Het
Cyp21a1 A T 17: 34,804,035 probably benign Het
Cyp26a1 A T 19: 37,700,623 L335F probably damaging Het
Dcst1 A G 3: 89,352,750 F596L probably damaging Het
Dennd6a T A 14: 26,606,954 L44H probably damaging Het
Dnah6 G A 6: 73,181,797 R608C possibly damaging Het
Dnajb5 A T 4: 42,957,333 T311S probably benign Het
Dthd1 A G 5: 62,827,229 T426A probably benign Het
Dync1h1 A G 12: 110,614,059 K118R probably damaging Het
Efemp1 A T 11: 28,921,442 D347V possibly damaging Het
Ephb4 T A 5: 137,354,415 Y87N probably damaging Het
Ern1 A T 11: 106,399,842 probably null Het
Fam184a A T 10: 53,647,084 D164E probably damaging Het
Fkbp10 A G 11: 100,423,219 E351G probably damaging Het
Fmn2 A G 1: 174,609,945 S1161G probably benign Het
Frem1 A G 4: 83,020,837 S3P possibly damaging Het
Gm10260 A G 13: 97,760,545 V15A probably benign Het
Gm281 A G 14: 13,899,619 I101T probably damaging Het
Gpr3 C T 4: 133,211,143 A73T possibly damaging Het
Gprc6a T C 10: 51,615,806 T616A probably benign Het
Gtf3c2 G T 5: 31,168,369 Q452K probably damaging Het
H2-Q7 C A 17: 35,439,699 S104R probably benign Het
Hacd2 T C 16: 35,102,064 Y208H probably damaging Het
Hid1 C T 11: 115,348,903 G734R probably damaging Het
Ifi207 A G 1: 173,732,426 I160T unknown Het
Itga11 T A 9: 62,782,018 L1155Q probably damaging Het
Kmt2d A G 15: 98,855,343 S157P probably damaging Het
Lamb3 A G 1: 193,334,879 T793A probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrrc66 G A 5: 73,607,426 S758L possibly damaging Het
Ltn1 C T 16: 87,400,146 S1213N possibly damaging Het
Med1 T C 11: 98,156,611 probably benign Het
Megf6 C T 4: 154,270,677 T1483M probably benign Het
Micall2 A G 5: 139,716,753 V245A probably benign Het
Mipep T G 14: 60,872,063 Y630D probably damaging Het
Ndst3 T A 3: 123,601,478 H501L probably benign Het
Nek10 A T 14: 14,842,789 M165L probably benign Het
Nmbr C A 10: 14,766,865 T56K probably benign Het
Nxpe2 T A 9: 48,326,152 M268L probably benign Het
Oasl2 A G 5: 114,901,306 Y185C probably benign Het
Ogdhl T A 14: 32,337,527 V377E probably damaging Het
Olfr115 G A 17: 37,609,839 S304L possibly damaging Het
Olfr738 T A 14: 50,414,201 probably null Het
Ovgp1 A G 3: 105,985,068 R346G probably benign Het
Parp14 T A 16: 35,858,588 N337Y possibly damaging Het
Pask A C 1: 93,320,769 probably null Het
Pax3 G T 1: 78,132,340 T227K probably damaging Het
Pik3r6 T A 11: 68,544,034 M594K probably benign Het
Pms1 A G 1: 53,207,211 F390L probably benign Het
Polg G A 7: 79,459,770 T433I probably benign Het
Prex1 T C 2: 166,585,101 Y898C probably damaging Het
Ranbp2 T A 10: 58,479,222 C1921* probably null Het
Rif1 T A 2: 52,078,495 L230* probably null Het
Rnf148 A G 6: 23,654,773 F75L probably damaging Het
Sclt1 A G 3: 41,727,111 V91A probably damaging Het
Sirt1 T C 10: 63,320,646 D735G probably benign Het
Spag5 T A 11: 78,314,256 N622K probably benign Het
Sspo T G 6: 48,489,786 C3935W probably damaging Het
Strbp A G 2: 37,625,265 S250P possibly damaging Het
Tgfbr2 T C 9: 116,090,536 T541A possibly damaging Het
Thada A C 17: 84,231,114 S1489A probably damaging Het
Tiam1 A T 16: 89,860,294 S685T probably benign Het
Tldc1 T C 8: 119,771,253 M171V probably null Het
Tpsb2 T A 17: 25,366,520 probably null Het
Trip4 C A 9: 65,858,340 G359V probably damaging Het
Tsr1 T C 11: 74,900,356 F254L probably benign Het
Vmn1r120 T C 7: 21,053,631 K52E probably benign Het
Vmn1r29 C A 6: 58,307,707 Y137* probably null Het
Vmn2r52 T C 7: 10,159,488 K575E probably damaging Het
Wdr95 A G 5: 149,552,426 Y63C probably damaging Het
Other mutations in Adam1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Adam1b APN 5 121500993 missense probably damaging 0.96
IGL01696:Adam1b APN 5 121500793 missense possibly damaging 0.73
IGL01906:Adam1b APN 5 121501475 missense probably benign 0.00
IGL02003:Adam1b APN 5 121501291 missense probably damaging 1.00
IGL02438:Adam1b APN 5 121501038 missense probably damaging 1.00
IGL02479:Adam1b APN 5 121501398 missense probably damaging 1.00
IGL03258:Adam1b APN 5 121501384 missense possibly damaging 0.94
PIT4519001:Adam1b UTSW 5 121501947 missense probably damaging 1.00
R1695:Adam1b UTSW 5 121500907 missense probably benign 0.02
R1816:Adam1b UTSW 5 121501725 missense probably damaging 0.99
R1833:Adam1b UTSW 5 121502937 missense possibly damaging 0.67
R1839:Adam1b UTSW 5 121501041 missense probably damaging 1.00
R2031:Adam1b UTSW 5 121501055 missense possibly damaging 0.73
R2110:Adam1b UTSW 5 121500714 intron probably benign
R2112:Adam1b UTSW 5 121500714 intron probably benign
R2570:Adam1b UTSW 5 121501748 missense probably damaging 1.00
R3020:Adam1b UTSW 5 121501383 missense possibly damaging 0.67
R4573:Adam1b UTSW 5 121500793 missense probably benign 0.18
R4574:Adam1b UTSW 5 121500793 missense probably benign 0.18
R5023:Adam1b UTSW 5 121501159 missense probably damaging 1.00
R5364:Adam1b UTSW 5 121500883 missense possibly damaging 0.75
R6553:Adam1b UTSW 5 121501187 missense probably benign 0.05
R6585:Adam1b UTSW 5 121501187 missense probably benign 0.05
R6600:Adam1b UTSW 5 121501467 missense probably damaging 1.00
R7285:Adam1b UTSW 5 121500993 missense probably damaging 0.96
R7549:Adam1b UTSW 5 121501918 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGCCTTGCATCAATAGCATG -3'
(R):5'- TCCAGATCAGGAGAGCTACTG -3'

Sequencing Primer
(F):5'- GCCTTGCATCAATAGCATGTAGGAC -3'
(R):5'- TGTCATTGACATTCAACACGCAGG -3'
Posted On2014-06-23