Mutagenetix > Incidental Mutation

Incidental Mutation 'R1831:Ephb4'

207318

Institutional Source

Beutler Lab

Gene Symbol

Ephb4

Ensembl Gene

ENSMUSG00000029710

Gene Name

Eph receptor B4

Synonyms

MDK2, Htk, Myk1, Tyro11

MMRRC Submission

039858-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1831 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

137350109-137378669 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 137354415 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 87 (Y87N)

Ref Sequence

ENSEMBL: ENSMUSP00000130275 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061244] [ENSMUST00000111054] [ENSMUST00000111055] [ENSMUST00000144296] [ENSMUST00000166239]

AlphaFold

P54761

Predicted Effect

probably damaging
Transcript: ENSMUST00000061244
AA Change: Y87N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000051622
Gene: ENSMUSG00000029710
AA Change: Y87N

Domain	Start	End	E-Value	Type
EPH_lbd	17	197	6.3e-106	SMART
Pfam:GCC2_GCC3	258	301	2.6e-11	PFAM
FN3	324	413	1.75e-6	SMART
FN3	434	516	1.07e-10	SMART
Pfam:EphA2_TM	540	612	8.9e-26	PFAM
TyrKc	615	874	5.09e-130	SMART
SAM	904	971	2.44e-21	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000111054
AA Change: Y87N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106683
Gene: ENSMUSG00000029710
AA Change: Y87N

Domain	Start	End	E-Value	Type
EPH_lbd	17	197	6.3e-106	SMART
Pfam:GCC2_GCC3	258	301	1.4e-11	PFAM
FN3	324	413	1.75e-6	SMART
FN3	434	516	1.07e-10	SMART
Pfam:EphA2_TM	540	612	3.4e-26	PFAM
TyrKc	615	874	5.09e-130	SMART
Pfam:SAM_1	882	917	2.6e-7	PFAM
low complexity region	919	934	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000111055
AA Change: Y87N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106684
Gene: ENSMUSG00000029710
AA Change: Y87N

Domain	Start	End	E-Value	Type
EPH_lbd	17	197	6.3e-106	SMART
Pfam:GCC2_GCC3	258	301	4.2e-10	PFAM
FN3	324	413	1.75e-6	SMART
FN3	443	525	1.07e-10	SMART
Pfam:EphA2_TM	550	621	5e-24	PFAM
TyrKc	624	883	5.09e-130	SMART
SAM	913	980	2.44e-21	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000144296
AA Change: Y87N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000115731
Gene: ENSMUSG00000029710
AA Change: Y87N

Domain	Start	End	E-Value	Type
EPH_lbd	17	197	6.3e-106	SMART
Pfam:GCC2_GCC3	258	301	2.6e-11	PFAM
FN3	324	413	1.75e-6	SMART
FN3	434	516	1.07e-10	SMART
Pfam:EphA2_TM	540	612	8.9e-26	PFAM
TyrKc	615	874	5.09e-130	SMART
SAM	904	971	2.44e-21	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000166239
AA Change: Y87N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000130275
Gene: ENSMUSG00000029710
AA Change: Y87N

Domain	Start	End	E-Value	Type
EPH_lbd	17	197	6.3e-106	SMART
Pfam:GCC2_GCC3	258	301	2.6e-11	PFAM
FN3	324	413	1.75e-6	SMART
FN3	434	516	1.07e-10	SMART
Pfam:EphA2_TM	540	612	8.9e-26	PFAM
TyrKc	615	874	5.09e-130	SMART
SAM	904	971	2.44e-21	SMART

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.2%
20x: 92.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. The protein encoded by this gene binds to ephrin-B2 and plays an essential role in vascular development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit arrested angiogenesis and heart development and midgestational lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700109H08Rik	A	G	5: 3,577,255	D77G	probably damaging	Het
Adam1b	A	G	5: 121,502,937	I15T	possibly damaging	Het
Arfgef1	G	C	1: 10,204,890	I312M	probably benign	Het
Capn8	G	A	1: 182,611,101		probably null	Het
Carmil1	A	T	13: 24,164,879	V15E	probably benign	Het
Ccdc42	T	A	11: 68,590,979	M133K	probably benign	Het
Cd5	T	C	19: 10,719,569	D485G	probably damaging	Het
Cep104	T	A	4: 154,002,546	V842E	probably benign	Het
Cep162	T	A	9: 87,206,932	I966L	probably damaging	Het
Cklf	T	C	8: 104,251,055	F13S	probably damaging	Het
Csf2rb	C	T	15: 78,348,253	P587S	probably benign	Het
Cyp21a1	A	T	17: 34,804,035		probably benign	Het
Cyp26a1	A	T	19: 37,700,623	L335F	probably damaging	Het
Dcst1	A	G	3: 89,352,750	F596L	probably damaging	Het
Dennd6a	T	A	14: 26,606,954	L44H	probably damaging	Het
Dnah6	G	A	6: 73,181,797	R608C	possibly damaging	Het
Dnajb5	A	T	4: 42,957,333	T311S	probably benign	Het
Dthd1	A	G	5: 62,827,229	T426A	probably benign	Het
Dync1h1	A	G	12: 110,614,059	K118R	probably damaging	Het
Efemp1	A	T	11: 28,921,442	D347V	possibly damaging	Het
Ern1	A	T	11: 106,399,842		probably null	Het
Fam184a	A	T	10: 53,647,084	D164E	probably damaging	Het
Fkbp10	A	G	11: 100,423,219	E351G	probably damaging	Het
Fmn2	A	G	1: 174,609,945	S1161G	probably benign	Het
Frem1	A	G	4: 83,020,837	S3P	possibly damaging	Het
Gm10260	A	G	13: 97,760,545	V15A	probably benign	Het
Gm281	A	G	14: 13,899,619	I101T	probably damaging	Het
Gpr3	C	T	4: 133,211,143	A73T	possibly damaging	Het
Gprc6a	T	C	10: 51,615,806	T616A	probably benign	Het
Gtf3c2	G	T	5: 31,168,369	Q452K	probably damaging	Het
H2-Q7	C	A	17: 35,439,699	S104R	probably benign	Het
Hacd2	T	C	16: 35,102,064	Y208H	probably damaging	Het
Hid1	C	T	11: 115,348,903	G734R	probably damaging	Het
Ifi207	A	G	1: 173,732,426	I160T	unknown	Het
Itga11	T	A	9: 62,782,018	L1155Q	probably damaging	Het
Kmt2d	A	G	15: 98,855,343	S157P	probably damaging	Het
Lamb3	A	G	1: 193,334,879	T793A	probably damaging	Het
Lonrf2	G	A	1: 38,813,276	P165S	probably benign	Het
Lrrc66	G	A	5: 73,607,426	S758L	possibly damaging	Het
Ltn1	C	T	16: 87,400,146	S1213N	possibly damaging	Het
Med1	T	C	11: 98,156,611		probably benign	Het
Megf6	C	T	4: 154,270,677	T1483M	probably benign	Het
Micall2	A	G	5: 139,716,753	V245A	probably benign	Het
Mipep	T	G	14: 60,872,063	Y630D	probably damaging	Het
Ndst3	T	A	3: 123,601,478	H501L	probably benign	Het
Nek10	A	T	14: 14,842,789	M165L	probably benign	Het
Nmbr	C	A	10: 14,766,865	T56K	probably benign	Het
Nxpe2	T	A	9: 48,326,152	M268L	probably benign	Het
Oasl2	A	G	5: 114,901,306	Y185C	probably benign	Het
Ogdhl	T	A	14: 32,337,527	V377E	probably damaging	Het
Olfr115	G	A	17: 37,609,839	S304L	possibly damaging	Het
Olfr738	T	A	14: 50,414,201		probably null	Het
Ovgp1	A	G	3: 105,985,068	R346G	probably benign	Het
Parp14	T	A	16: 35,858,588	N337Y	possibly damaging	Het
Pask	A	C	1: 93,320,769		probably null	Het
Pax3	G	T	1: 78,132,340	T227K	probably damaging	Het
Pik3r6	T	A	11: 68,544,034	M594K	probably benign	Het
Pms1	A	G	1: 53,207,211	F390L	probably benign	Het
Polg	G	A	7: 79,459,770	T433I	probably benign	Het
Prex1	T	C	2: 166,585,101	Y898C	probably damaging	Het
Ranbp2	T	A	10: 58,479,222	C1921*	probably null	Het
Rif1	T	A	2: 52,078,495	L230*	probably null	Het
Rnf148	A	G	6: 23,654,773	F75L	probably damaging	Het
Sclt1	A	G	3: 41,727,111	V91A	probably damaging	Het
Sirt1	T	C	10: 63,320,646	D735G	probably benign	Het
Spag5	T	A	11: 78,314,256	N622K	probably benign	Het
Sspo	T	G	6: 48,489,786	C3935W	probably damaging	Het
Strbp	A	G	2: 37,625,265	S250P	possibly damaging	Het
Tgfbr2	T	C	9: 116,090,536	T541A	possibly damaging	Het
Thada	A	C	17: 84,231,114	S1489A	probably damaging	Het
Tiam1	A	T	16: 89,860,294	S685T	probably benign	Het
Tldc1	T	C	8: 119,771,253	M171V	probably null	Het
Tpsb2	T	A	17: 25,366,520		probably null	Het
Trip4	C	A	9: 65,858,340	G359V	probably damaging	Het
Tsr1	T	C	11: 74,900,356	F254L	probably benign	Het
Vmn1r120	T	C	7: 21,053,631	K52E	probably benign	Het
Vmn1r29	C	A	6: 58,307,707	Y137*	probably null	Het
Vmn2r52	T	C	7: 10,159,488	K575E	probably damaging	Het
Wdr95	A	G	5: 149,552,426	Y63C	probably damaging	Het

Other mutations in Ephb4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00542:Ephb4	APN	5	137365615	splice site	probably benign
IGL00948:Ephb4	APN	5	137366659	missense	probably damaging	1.00
IGL01653:Ephb4	APN	5	137365741	splice site	probably benign
IGL01885:Ephb4	APN	5	137357797	missense	probably damaging	1.00
IGL01906:Ephb4	APN	5	137361194	missense	probably damaging	1.00
IGL02089:Ephb4	APN	5	137370762	missense	probably damaging	0.98
IGL02216:Ephb4	APN	5	137372070	missense	possibly damaging	0.92
IGL02233:Ephb4	APN	5	137354501	nonsense	probably null
IGL03080:Ephb4	APN	5	137354083	splice site	probably benign
IGL03111:Ephb4	APN	5	137372505	missense	probably benign	0.07
R0599:Ephb4	UTSW	5	137369855	missense	probably damaging	1.00
R0744:Ephb4	UTSW	5	137365667	missense	probably damaging	1.00
R1331:Ephb4	UTSW	5	137366534	splice site	probably benign
R1441:Ephb4	UTSW	5	137361247	missense	probably damaging	1.00
R1732:Ephb4	UTSW	5	137372178	missense	possibly damaging	0.93
R1745:Ephb4	UTSW	5	137360434	missense	probably benign
R1865:Ephb4	UTSW	5	137363310	missense	possibly damaging	0.53
R2165:Ephb4	UTSW	5	137354426	missense	probably benign	0.08
R2206:Ephb4	UTSW	5	137357719	missense	probably damaging	1.00
R2473:Ephb4	UTSW	5	137365700	missense	probably benign	0.15
R4779:Ephb4	UTSW	5	137365702	missense	probably benign	0.04
R4801:Ephb4	UTSW	5	137365506	missense	probably damaging	1.00
R4802:Ephb4	UTSW	5	137365506	missense	probably damaging	1.00
R5307:Ephb4	UTSW	5	137363312	missense	probably damaging	1.00
R5452:Ephb4	UTSW	5	137361142	missense	probably damaging	1.00
R5458:Ephb4	UTSW	5	137369852	missense	probably damaging	1.00
R5475:Ephb4	UTSW	5	137354439	missense	probably benign	0.00
R5662:Ephb4	UTSW	5	137372195	missense	probably damaging	0.98
R5879:Ephb4	UTSW	5	137360416	missense	probably benign	0.00
R6336:Ephb4	UTSW	5	137372085	missense	probably damaging	1.00
R6443:Ephb4	UTSW	5	137360449	missense	probably damaging	1.00
R6632:Ephb4	UTSW	5	137366587	missense	probably damaging	0.99
R6973:Ephb4	UTSW	5	137369804	missense	probably damaging	1.00
R7008:Ephb4	UTSW	5	137361274	missense	probably benign	0.00
R7145:Ephb4	UTSW	5	137372046	missense	probably damaging	1.00
R7421:Ephb4	UTSW	5	137354425	missense	possibly damaging	0.88
R7593:Ephb4	UTSW	5	137361298	missense	probably benign
R7635:Ephb4	UTSW	5	137372103	missense	probably damaging	1.00
R7751:Ephb4	UTSW	5	137365675	missense	probably damaging	1.00
R7825:Ephb4	UTSW	5	137372437	missense	probably damaging	1.00
R8539:Ephb4	UTSW	5	137357855	missense	probably damaging	1.00
R8904:Ephb4	UTSW	5	137370805	missense	probably damaging	1.00
R9228:Ephb4	UTSW	5	137354562	missense	possibly damaging	0.79
R9327:Ephb4	UTSW	5	137363267	missense	probably damaging	0.99
R9513:Ephb4	UTSW	5	137363302	missense	possibly damaging	0.76
R9659:Ephb4	UTSW	5	137365481	missense	probably damaging	1.00
R9788:Ephb4	UTSW	5	137365481	missense	probably damaging	1.00
X0026:Ephb4	UTSW	5	137373558	missense	probably damaging	1.00
Z1177:Ephb4	UTSW	5	137361359	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- ACTGAAGCAGGAGGTTGCAC -3'
(R):5'- CCCAGACTGTTGGTACCTTG -3'

Sequencing Primer
(F):5'- GAAACACTCCGAGATACTTGTTTCC -3'
(R):5'- CCCAGACTGTTGGTACCTTGATGTAG -3'

Posted On

2014-06-23