Incidental Mutation 'R1831:Vmn2r52'
ID207325
Institutional Source Beutler Lab
Gene Symbol Vmn2r52
Ensembl Gene ENSMUSG00000091930
Gene Namevomeronasal 2, receptor 52
SynonymsEG384534
MMRRC Submission 039858-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R1831 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location10158652-10176286 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10159488 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 575 (K575E)
Ref Sequence ENSEMBL: ENSMUSP00000129352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164918]
Predicted Effect probably damaging
Transcript: ENSMUST00000164918
AA Change: K575E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129352
Gene: ENSMUSG00000091930
AA Change: K575E

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 8.1e-29 PFAM
Pfam:NCD3G 512 565 1.5e-19 PFAM
Pfam:7tm_3 596 833 1.1e-55 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700109H08Rik A G 5: 3,577,255 D77G probably damaging Het
Adam1b A G 5: 121,502,937 I15T possibly damaging Het
Arfgef1 G C 1: 10,204,890 I312M probably benign Het
Capn8 G A 1: 182,611,101 probably null Het
Carmil1 A T 13: 24,164,879 V15E probably benign Het
Ccdc42 T A 11: 68,590,979 M133K probably benign Het
Cd5 T C 19: 10,719,569 D485G probably damaging Het
Cep104 T A 4: 154,002,546 V842E probably benign Het
Cep162 T A 9: 87,206,932 I966L probably damaging Het
Cklf T C 8: 104,251,055 F13S probably damaging Het
Csf2rb C T 15: 78,348,253 P587S probably benign Het
Cyp21a1 A T 17: 34,804,035 probably benign Het
Cyp26a1 A T 19: 37,700,623 L335F probably damaging Het
Dcst1 A G 3: 89,352,750 F596L probably damaging Het
Dennd6a T A 14: 26,606,954 L44H probably damaging Het
Dnah6 G A 6: 73,181,797 R608C possibly damaging Het
Dnajb5 A T 4: 42,957,333 T311S probably benign Het
Dthd1 A G 5: 62,827,229 T426A probably benign Het
Dync1h1 A G 12: 110,614,059 K118R probably damaging Het
Efemp1 A T 11: 28,921,442 D347V possibly damaging Het
Ephb4 T A 5: 137,354,415 Y87N probably damaging Het
Ern1 A T 11: 106,399,842 probably null Het
Fam184a A T 10: 53,647,084 D164E probably damaging Het
Fkbp10 A G 11: 100,423,219 E351G probably damaging Het
Fmn2 A G 1: 174,609,945 S1161G probably benign Het
Frem1 A G 4: 83,020,837 S3P possibly damaging Het
Gm10260 A G 13: 97,760,545 V15A probably benign Het
Gm281 A G 14: 13,899,619 I101T probably damaging Het
Gpr3 C T 4: 133,211,143 A73T possibly damaging Het
Gprc6a T C 10: 51,615,806 T616A probably benign Het
Gtf3c2 G T 5: 31,168,369 Q452K probably damaging Het
H2-Q7 C A 17: 35,439,699 S104R probably benign Het
Hacd2 T C 16: 35,102,064 Y208H probably damaging Het
Hid1 C T 11: 115,348,903 G734R probably damaging Het
Ifi207 A G 1: 173,732,426 I160T unknown Het
Itga11 T A 9: 62,782,018 L1155Q probably damaging Het
Kmt2d A G 15: 98,855,343 S157P probably damaging Het
Lamb3 A G 1: 193,334,879 T793A probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrrc66 G A 5: 73,607,426 S758L possibly damaging Het
Ltn1 C T 16: 87,400,146 S1213N possibly damaging Het
Med1 T C 11: 98,156,611 probably benign Het
Megf6 C T 4: 154,270,677 T1483M probably benign Het
Micall2 A G 5: 139,716,753 V245A probably benign Het
Mipep T G 14: 60,872,063 Y630D probably damaging Het
Ndst3 T A 3: 123,601,478 H501L probably benign Het
Nek10 A T 14: 14,842,789 M165L probably benign Het
Nmbr C A 10: 14,766,865 T56K probably benign Het
Nxpe2 T A 9: 48,326,152 M268L probably benign Het
Oasl2 A G 5: 114,901,306 Y185C probably benign Het
Ogdhl T A 14: 32,337,527 V377E probably damaging Het
Olfr115 G A 17: 37,609,839 S304L possibly damaging Het
Olfr738 T A 14: 50,414,201 probably null Het
Ovgp1 A G 3: 105,985,068 R346G probably benign Het
Parp14 T A 16: 35,858,588 N337Y possibly damaging Het
Pask A C 1: 93,320,769 probably null Het
Pax3 G T 1: 78,132,340 T227K probably damaging Het
Pik3r6 T A 11: 68,544,034 M594K probably benign Het
Pms1 A G 1: 53,207,211 F390L probably benign Het
Polg G A 7: 79,459,770 T433I probably benign Het
Prex1 T C 2: 166,585,101 Y898C probably damaging Het
Ranbp2 T A 10: 58,479,222 C1921* probably null Het
Rif1 T A 2: 52,078,495 L230* probably null Het
Rnf148 A G 6: 23,654,773 F75L probably damaging Het
Sclt1 A G 3: 41,727,111 V91A probably damaging Het
Sirt1 T C 10: 63,320,646 D735G probably benign Het
Spag5 T A 11: 78,314,256 N622K probably benign Het
Sspo T G 6: 48,489,786 C3935W probably damaging Het
Strbp A G 2: 37,625,265 S250P possibly damaging Het
Tgfbr2 T C 9: 116,090,536 T541A possibly damaging Het
Thada A C 17: 84,231,114 S1489A probably damaging Het
Tiam1 A T 16: 89,860,294 S685T probably benign Het
Tldc1 T C 8: 119,771,253 M171V probably null Het
Tpsb2 T A 17: 25,366,520 probably null Het
Trip4 C A 9: 65,858,340 G359V probably damaging Het
Tsr1 T C 11: 74,900,356 F254L probably benign Het
Vmn1r120 T C 7: 21,053,631 K52E probably benign Het
Vmn1r29 C A 6: 58,307,707 Y137* probably null Het
Wdr95 A G 5: 149,552,426 Y63C probably damaging Het
Other mutations in Vmn2r52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Vmn2r52 APN 7 10169096 missense probably benign 0.30
IGL00328:Vmn2r52 APN 7 10171417 missense probably benign 0.12
IGL00980:Vmn2r52 APN 7 10171090 missense probably damaging 1.00
IGL01468:Vmn2r52 APN 7 10158941 missense probably damaging 1.00
IGL01660:Vmn2r52 APN 7 10159180 missense probably damaging 0.97
IGL02215:Vmn2r52 APN 7 10171102 missense probably damaging 0.97
IGL03030:Vmn2r52 APN 7 10158872 missense probably benign 0.12
IGL03212:Vmn2r52 APN 7 10159547 missense possibly damaging 0.47
FR4589:Vmn2r52 UTSW 7 10159020 missense probably damaging 0.97
PIT4283001:Vmn2r52 UTSW 7 10170829 missense possibly damaging 0.89
R0184:Vmn2r52 UTSW 7 10159338 missense probably damaging 1.00
R0190:Vmn2r52 UTSW 7 10171388 missense probably benign 0.00
R0240:Vmn2r52 UTSW 7 10159400 missense probably damaging 0.99
R0240:Vmn2r52 UTSW 7 10159400 missense probably damaging 0.99
R0257:Vmn2r52 UTSW 7 10171055 nonsense probably null
R0310:Vmn2r52 UTSW 7 10159466 missense probably damaging 1.00
R1862:Vmn2r52 UTSW 7 10173406 missense possibly damaging 0.94
R2484:Vmn2r52 UTSW 7 10169131 missense probably damaging 0.96
R2510:Vmn2r52 UTSW 7 10170868 missense probably benign
R3625:Vmn2r52 UTSW 7 10159178 missense probably damaging 1.00
R3803:Vmn2r52 UTSW 7 10173512 missense probably damaging 1.00
R4013:Vmn2r52 UTSW 7 10170676 missense probably benign 0.00
R4283:Vmn2r52 UTSW 7 10170638 missense possibly damaging 0.60
R4324:Vmn2r52 UTSW 7 10171013 missense possibly damaging 0.94
R4578:Vmn2r52 UTSW 7 10170690 missense probably damaging 1.00
R4806:Vmn2r52 UTSW 7 10159242 missense probably damaging 1.00
R5083:Vmn2r52 UTSW 7 10159465 nonsense probably null
R5249:Vmn2r52 UTSW 7 10176270 missense probably benign
R5306:Vmn2r52 UTSW 7 10170745 missense possibly damaging 0.88
R5332:Vmn2r52 UTSW 7 10169125 missense probably benign 0.17
R5617:Vmn2r52 UTSW 7 10170934 missense probably damaging 0.99
R5643:Vmn2r52 UTSW 7 10171132 missense probably damaging 1.00
R5749:Vmn2r52 UTSW 7 10159032 missense probably damaging 1.00
R5763:Vmn2r52 UTSW 7 10171304 missense probably benign 0.01
R6103:Vmn2r52 UTSW 7 10171400 missense probably benign 0.36
R6148:Vmn2r52 UTSW 7 10171163 missense probably benign 0.00
R6356:Vmn2r52 UTSW 7 10168999 missense probably benign 0.01
R6412:Vmn2r52 UTSW 7 10171009 missense probably benign
R6657:Vmn2r52 UTSW 7 10159163 missense probably damaging 0.99
R6997:Vmn2r52 UTSW 7 10169071 missense probably benign 0.06
R7395:Vmn2r52 UTSW 7 10170817 missense probably benign 0.00
R7621:Vmn2r52 UTSW 7 10173347 missense probably benign 0.00
R7691:Vmn2r52 UTSW 7 10159182 missense probably damaging 0.97
R7852:Vmn2r52 UTSW 7 10158968 missense probably damaging 1.00
R7908:Vmn2r52 UTSW 7 10162950 missense probably benign
R7909:Vmn2r52 UTSW 7 10162950 missense probably benign
R7912:Vmn2r52 UTSW 7 10162950 missense probably benign
R7913:Vmn2r52 UTSW 7 10162950 missense probably benign
R7938:Vmn2r52 UTSW 7 10159373 missense probably benign 0.12
Z1176:Vmn2r52 UTSW 7 10171200 missense probably damaging 0.97
Z1177:Vmn2r52 UTSW 7 10169190 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CACAGGTGACTCTGTTAGGG -3'
(R):5'- TATTTCCAGCATCAGGGCAG -3'

Sequencing Primer
(F):5'- TGCACAGAAAACAGAACATGAGTGAC -3'
(R):5'- GCATTGCAAGGCTCCTGTCAAC -3'
Posted On2014-06-23