Incidental Mutation 'R1831:Pik3r6'
ID207346
Institutional Source Beutler Lab
Gene Symbol Pik3r6
Ensembl Gene ENSMUSG00000046207
Gene Namephosphoinositide-3-kinase regulatory subunit 5
Synonyms
MMRRC Submission 039858-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R1831 (G1)
Quality Score144
Status Not validated
Chromosome11
Chromosomal Location68503019-68552698 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 68544034 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 594 (M594K)
Ref Sequence ENSEMBL: ENSMUSP00000052522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060441] [ENSMUST00000102613]
Predicted Effect probably benign
Transcript: ENSMUST00000060441
AA Change: M594K

PolyPhen 2 Score 0.262 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000052522
Gene: ENSMUSG00000046207
AA Change: M594K

DomainStartEndE-ValueType
Pfam:PI3K_1B_p101 7 306 7.4e-28 PFAM
low complexity region 310 324 N/A INTRINSIC
Pfam:PI3K_1B_p101 394 755 1.2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102613
AA Change: M590K

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099673
Gene: ENSMUSG00000046207
AA Change: M590K

DomainStartEndE-ValueType
Pfam:PI3K_1B_p101 3 335 1.8e-111 PFAM
Pfam:PI3K_1B_p101 332 752 1.6e-126 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126069
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153671
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: Phosphoinositide 3-kinase gamma is a lipid kinase that produces the lipid second messenger phosphatidylinositol 3,4,5-trisphosphate. The kinase is composed of a catalytic subunit and one of several regulatory subunits, and is chiefly activated by G protein-coupled receptors. This gene encodes a regulatory subunit, and is distantly related to the phosphoinositide-3-kinase, regulatory subunit 5 gene which is located adjacent to this gene on chromosome 11. The protein binds to both the catalytic subunit and to G beta-gamma, and mediates activation of the kinase subunit downstream of G protein-coupled receptors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit small reductions in lymphocyte and granulocyte and a slight increase in neutrophils. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700109H08Rik A G 5: 3,577,255 D77G probably damaging Het
Adam1b A G 5: 121,502,937 I15T possibly damaging Het
Arfgef1 G C 1: 10,204,890 I312M probably benign Het
Capn8 G A 1: 182,611,101 probably null Het
Carmil1 A T 13: 24,164,879 V15E probably benign Het
Ccdc42 T A 11: 68,590,979 M133K probably benign Het
Cd5 T C 19: 10,719,569 D485G probably damaging Het
Cep104 T A 4: 154,002,546 V842E probably benign Het
Cep162 T A 9: 87,206,932 I966L probably damaging Het
Cklf T C 8: 104,251,055 F13S probably damaging Het
Csf2rb C T 15: 78,348,253 P587S probably benign Het
Cyp21a1 A T 17: 34,804,035 probably benign Het
Cyp26a1 A T 19: 37,700,623 L335F probably damaging Het
Dcst1 A G 3: 89,352,750 F596L probably damaging Het
Dennd6a T A 14: 26,606,954 L44H probably damaging Het
Dnah6 G A 6: 73,181,797 R608C possibly damaging Het
Dnajb5 A T 4: 42,957,333 T311S probably benign Het
Dthd1 A G 5: 62,827,229 T426A probably benign Het
Dync1h1 A G 12: 110,614,059 K118R probably damaging Het
Efemp1 A T 11: 28,921,442 D347V possibly damaging Het
Ephb4 T A 5: 137,354,415 Y87N probably damaging Het
Ern1 A T 11: 106,399,842 probably null Het
Fam184a A T 10: 53,647,084 D164E probably damaging Het
Fkbp10 A G 11: 100,423,219 E351G probably damaging Het
Fmn2 A G 1: 174,609,945 S1161G probably benign Het
Frem1 A G 4: 83,020,837 S3P possibly damaging Het
Gm10260 A G 13: 97,760,545 V15A probably benign Het
Gm281 A G 14: 13,899,619 I101T probably damaging Het
Gpr3 C T 4: 133,211,143 A73T possibly damaging Het
Gprc6a T C 10: 51,615,806 T616A probably benign Het
Gtf3c2 G T 5: 31,168,369 Q452K probably damaging Het
H2-Q7 C A 17: 35,439,699 S104R probably benign Het
Hacd2 T C 16: 35,102,064 Y208H probably damaging Het
Hid1 C T 11: 115,348,903 G734R probably damaging Het
Ifi207 A G 1: 173,732,426 I160T unknown Het
Itga11 T A 9: 62,782,018 L1155Q probably damaging Het
Kmt2d A G 15: 98,855,343 S157P probably damaging Het
Lamb3 A G 1: 193,334,879 T793A probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrrc66 G A 5: 73,607,426 S758L possibly damaging Het
Ltn1 C T 16: 87,400,146 S1213N possibly damaging Het
Med1 T C 11: 98,156,611 probably benign Het
Megf6 C T 4: 154,270,677 T1483M probably benign Het
Micall2 A G 5: 139,716,753 V245A probably benign Het
Mipep T G 14: 60,872,063 Y630D probably damaging Het
Ndst3 T A 3: 123,601,478 H501L probably benign Het
Nek10 A T 14: 14,842,789 M165L probably benign Het
Nmbr C A 10: 14,766,865 T56K probably benign Het
Nxpe2 T A 9: 48,326,152 M268L probably benign Het
Oasl2 A G 5: 114,901,306 Y185C probably benign Het
Ogdhl T A 14: 32,337,527 V377E probably damaging Het
Olfr115 G A 17: 37,609,839 S304L possibly damaging Het
Olfr738 T A 14: 50,414,201 probably null Het
Ovgp1 A G 3: 105,985,068 R346G probably benign Het
Parp14 T A 16: 35,858,588 N337Y possibly damaging Het
Pask A C 1: 93,320,769 probably null Het
Pax3 G T 1: 78,132,340 T227K probably damaging Het
Pms1 A G 1: 53,207,211 F390L probably benign Het
Polg G A 7: 79,459,770 T433I probably benign Het
Prex1 T C 2: 166,585,101 Y898C probably damaging Het
Ranbp2 T A 10: 58,479,222 C1921* probably null Het
Rif1 T A 2: 52,078,495 L230* probably null Het
Rnf148 A G 6: 23,654,773 F75L probably damaging Het
Sclt1 A G 3: 41,727,111 V91A probably damaging Het
Sirt1 T C 10: 63,320,646 D735G probably benign Het
Spag5 T A 11: 78,314,256 N622K probably benign Het
Sspo T G 6: 48,489,786 C3935W probably damaging Het
Strbp A G 2: 37,625,265 S250P possibly damaging Het
Tgfbr2 T C 9: 116,090,536 T541A possibly damaging Het
Thada A C 17: 84,231,114 S1489A probably damaging Het
Tiam1 A T 16: 89,860,294 S685T probably benign Het
Tldc1 T C 8: 119,771,253 M171V probably null Het
Tpsb2 T A 17: 25,366,520 probably null Het
Trip4 C A 9: 65,858,340 G359V probably damaging Het
Tsr1 T C 11: 74,900,356 F254L probably benign Het
Vmn1r120 T C 7: 21,053,631 K52E probably benign Het
Vmn1r29 C A 6: 58,307,707 Y137* probably null Het
Vmn2r52 T C 7: 10,159,488 K575E probably damaging Het
Wdr95 A G 5: 149,552,426 Y63C probably damaging Het
Other mutations in Pik3r6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Pik3r6 APN 11 68534251 missense probably damaging 0.98
IGL00913:Pik3r6 APN 11 68551321 missense probably damaging 1.00
IGL00984:Pik3r6 APN 11 68533619 missense probably benign 0.39
IGL01110:Pik3r6 APN 11 68528826 critical splice donor site probably null
IGL01116:Pik3r6 APN 11 68531450 missense probably benign 0.01
IGL02839:Pik3r6 APN 11 68526412 missense probably damaging 1.00
PIT4142001:Pik3r6 UTSW 11 68527105 missense probably damaging 1.00
R0044:Pik3r6 UTSW 11 68544750 missense probably benign 0.02
R0062:Pik3r6 UTSW 11 68528809 missense probably damaging 1.00
R0062:Pik3r6 UTSW 11 68528809 missense probably damaging 1.00
R0266:Pik3r6 UTSW 11 68526408 nonsense probably null
R0454:Pik3r6 UTSW 11 68528782 missense possibly damaging 0.88
R0906:Pik3r6 UTSW 11 68536101 splice site probably benign
R1119:Pik3r6 UTSW 11 68545872 missense probably benign 0.05
R1440:Pik3r6 UTSW 11 68531445 missense possibly damaging 0.91
R1664:Pik3r6 UTSW 11 68536106 missense probably benign
R2144:Pik3r6 UTSW 11 68543611 nonsense probably null
R4013:Pik3r6 UTSW 11 68533521 missense possibly damaging 0.85
R4754:Pik3r6 UTSW 11 68544775 missense probably damaging 1.00
R4770:Pik3r6 UTSW 11 68529894 missense probably damaging 1.00
R4860:Pik3r6 UTSW 11 68544053 splice site probably benign
R4974:Pik3r6 UTSW 11 68539945 missense probably damaging 1.00
R5033:Pik3r6 UTSW 11 68533468 nonsense probably null
R5787:Pik3r6 UTSW 11 68539927 missense possibly damaging 0.54
R5918:Pik3r6 UTSW 11 68525671 nonsense probably null
R6164:Pik3r6 UTSW 11 68551973 missense probably benign 0.00
R6192:Pik3r6 UTSW 11 68543629 missense probably damaging 1.00
R6440:Pik3r6 UTSW 11 68533696 missense probably benign 0.09
R7699:Pik3r6 UTSW 11 68528563 missense probably damaging 1.00
R7700:Pik3r6 UTSW 11 68528563 missense probably damaging 1.00
R7922:Pik3r6 UTSW 11 68533875 missense probably benign 0.00
R7964:Pik3r6 UTSW 11 68533739 missense probably benign 0.01
R8515:Pik3r6 UTSW 11 68539957 missense probably damaging 1.00
W0251:Pik3r6 UTSW 11 68533871 missense probably benign 0.01
Z1088:Pik3r6 UTSW 11 68525602 missense probably damaging 0.98
Z1176:Pik3r6 UTSW 11 68520200 start gained probably benign
Z1176:Pik3r6 UTSW 11 68544765 missense probably benign 0.12
Z1177:Pik3r6 UTSW 11 68551227 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCAGACTGAAAGGCCATCTTC -3'
(R):5'- TGCCTCCTTGTCTACATGTAAGG -3'

Sequencing Primer
(F):5'- CTCAGATGTTGCCTCTCCATCCAG -3'
(R):5'- TACACCATCGTTGCAGATTGC -3'
Posted On2014-06-23