Mutagenetix > Incidental Mutations

Incidental Mutation 'R1831:Med1'

207350

Institutional Source

Beutler Lab

Gene Symbol

Med1

Ensembl Gene

ENSMUSG00000018160

Gene Name

mediator complex subunit 1

Synonyms

Pparbp, l11Jus15, PBP, TRAP 220, CRSP210, DRIP205, TRAP220

MMRRC Submission

039858-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1831 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

98152154-98193293 bp(-) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

T to C at 98156611 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000090411 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018304] [ENSMUST00000092735] [ENSMUST00000107545]

Predicted Effect

unknown
Transcript: ENSMUST00000018304
AA Change: K1105E

SMART Domains

Protein: ENSMUSP00000018304
Gene: ENSMUSG00000018160
AA Change: K1105E

Domain	Start	End	E-Value	Type
Pfam:Med1	18	414	3.7e-112	PFAM
low complexity region	536	559	N/A	INTRINSIC
low complexity region	595	619	N/A	INTRINSIC
low complexity region	667	678	N/A	INTRINSIC
low complexity region	960	981	N/A	INTRINSIC
low complexity region	989	999	N/A	INTRINSIC
low complexity region	1015	1036	N/A	INTRINSIC
low complexity region	1042	1054	N/A	INTRINSIC
low complexity region	1063	1138	N/A	INTRINSIC
low complexity region	1170	1183	N/A	INTRINSIC
low complexity region	1205	1243	N/A	INTRINSIC
low complexity region	1250	1281	N/A	INTRINSIC
low complexity region	1344	1364	N/A	INTRINSIC
low complexity region	1482	1503	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000092735

SMART Domains

Protein: ENSMUSP00000090411
Gene: ENSMUSG00000018160

Domain	Start	End	E-Value	Type
Pfam:Med1	33	429	1.2e-113	PFAM
transmembrane domain	585	607	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000107545
AA Change: K1120E

SMART Domains

Protein: ENSMUSP00000103169
Gene: ENSMUSG00000018160
AA Change: K1120E

Domain	Start	End	E-Value	Type
Pfam:Med1	59	426	2.9e-74	PFAM
low complexity region	551	574	N/A	INTRINSIC
low complexity region	610	634	N/A	INTRINSIC
low complexity region	682	693	N/A	INTRINSIC
low complexity region	975	996	N/A	INTRINSIC
low complexity region	1004	1014	N/A	INTRINSIC
low complexity region	1030	1051	N/A	INTRINSIC
low complexity region	1057	1069	N/A	INTRINSIC
low complexity region	1078	1153	N/A	INTRINSIC
low complexity region	1185	1198	N/A	INTRINSIC
low complexity region	1220	1258	N/A	INTRINSIC
low complexity region	1265	1296	N/A	INTRINSIC
low complexity region	1359	1379	N/A	INTRINSIC
low complexity region	1497	1518	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126483

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147933

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.2%
20x: 92.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. It also regulates p53-dependent apoptosis and it is essential for adipogenesis. This protein is known to have the ability to self-oligomerize. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations have defects of placental vasculature, heart, and lens, arrested erythrocytic differentiation, impaired neuronal development, and die by embryonic day 11.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700109H08Rik	A	G	5: 3,577,255	D77G	probably damaging	Het
Adam1b	A	G	5: 121,502,937	I15T	possibly damaging	Het
Arfgef1	G	C	1: 10,204,890	I312M	probably benign	Het
Capn8	G	A	1: 182,611,101		probably null	Het
Carmil1	A	T	13: 24,164,879	V15E	probably benign	Het
Ccdc42	T	A	11: 68,590,979	M133K	probably benign	Het
Cd5	T	C	19: 10,719,569	D485G	probably damaging	Het
Cep104	T	A	4: 154,002,546	V842E	probably benign	Het
Cep162	T	A	9: 87,206,932	I966L	probably damaging	Het
Cklf	T	C	8: 104,251,055	F13S	probably damaging	Het
Csf2rb	C	T	15: 78,348,253	P587S	probably benign	Het
Cyp21a1	A	T	17: 34,804,035		probably benign	Het
Cyp26a1	A	T	19: 37,700,623	L335F	probably damaging	Het
Dcst1	A	G	3: 89,352,750	F596L	probably damaging	Het
Dennd6a	T	A	14: 26,606,954	L44H	probably damaging	Het
Dnah6	G	A	6: 73,181,797	R608C	possibly damaging	Het
Dnajb5	A	T	4: 42,957,333	T311S	probably benign	Het
Dthd1	A	G	5: 62,827,229	T426A	probably benign	Het
Dync1h1	A	G	12: 110,614,059	K118R	probably damaging	Het
Efemp1	A	T	11: 28,921,442	D347V	possibly damaging	Het
Ephb4	T	A	5: 137,354,415	Y87N	probably damaging	Het
Ern1	A	T	11: 106,399,842		probably null	Het
Fam184a	A	T	10: 53,647,084	D164E	probably damaging	Het
Fkbp10	A	G	11: 100,423,219	E351G	probably damaging	Het
Fmn2	A	G	1: 174,609,945	S1161G	probably benign	Het
Frem1	A	G	4: 83,020,837	S3P	possibly damaging	Het
Gm10260	A	G	13: 97,760,545	V15A	probably benign	Het
Gm281	A	G	14: 13,899,619	I101T	probably damaging	Het
Gpr3	C	T	4: 133,211,143	A73T	possibly damaging	Het
Gprc6a	T	C	10: 51,615,806	T616A	probably benign	Het
Gtf3c2	G	T	5: 31,168,369	Q452K	probably damaging	Het
H2-Q7	C	A	17: 35,439,699	S104R	probably benign	Het
Hacd2	T	C	16: 35,102,064	Y208H	probably damaging	Het
Hid1	C	T	11: 115,348,903	G734R	probably damaging	Het
Ifi207	A	G	1: 173,732,426	I160T	unknown	Het
Itga11	T	A	9: 62,782,018	L1155Q	probably damaging	Het
Kmt2d	A	G	15: 98,855,343	S157P	probably damaging	Het
Lamb3	A	G	1: 193,334,879	T793A	probably damaging	Het
Lonrf2	G	A	1: 38,813,276	P165S	probably benign	Het
Lrrc66	G	A	5: 73,607,426	S758L	possibly damaging	Het
Ltn1	C	T	16: 87,400,146	S1213N	possibly damaging	Het
Megf6	C	T	4: 154,270,677	T1483M	probably benign	Het
Micall2	A	G	5: 139,716,753	V245A	probably benign	Het
Mipep	T	G	14: 60,872,063	Y630D	probably damaging	Het
Ndst3	T	A	3: 123,601,478	H501L	probably benign	Het
Nek10	A	T	14: 14,842,789	M165L	probably benign	Het
Nmbr	C	A	10: 14,766,865	T56K	probably benign	Het
Nxpe2	T	A	9: 48,326,152	M268L	probably benign	Het
Oasl2	A	G	5: 114,901,306	Y185C	probably benign	Het
Ogdhl	T	A	14: 32,337,527	V377E	probably damaging	Het
Olfr115	G	A	17: 37,609,839	S304L	possibly damaging	Het
Olfr738	T	A	14: 50,414,201		probably null	Het
Ovgp1	A	G	3: 105,985,068	R346G	probably benign	Het
Parp14	T	A	16: 35,858,588	N337Y	possibly damaging	Het
Pask	A	C	1: 93,320,769		probably null	Het
Pax3	G	T	1: 78,132,340	T227K	probably damaging	Het
Pik3r6	T	A	11: 68,544,034	M594K	probably benign	Het
Pms1	A	G	1: 53,207,211	F390L	probably benign	Het
Polg	G	A	7: 79,459,770	T433I	probably benign	Het
Prex1	T	C	2: 166,585,101	Y898C	probably damaging	Het
Ranbp2	T	A	10: 58,479,222	C1921*	probably null	Het
Rif1	T	A	2: 52,078,495	L230*	probably null	Het
Rnf148	A	G	6: 23,654,773	F75L	probably damaging	Het
Sclt1	A	G	3: 41,727,111	V91A	probably damaging	Het
Sirt1	T	C	10: 63,320,646	D735G	probably benign	Het
Spag5	T	A	11: 78,314,256	N622K	probably benign	Het
Sspo	T	G	6: 48,489,786	C3935W	probably damaging	Het
Strbp	A	G	2: 37,625,265	S250P	possibly damaging	Het
Tgfbr2	T	C	9: 116,090,536	T541A	possibly damaging	Het
Thada	A	C	17: 84,231,114	S1489A	probably damaging	Het
Tiam1	A	T	16: 89,860,294	S685T	probably benign	Het
Tldc1	T	C	8: 119,771,253	M171V	probably null	Het
Tpsb2	T	A	17: 25,366,520		probably null	Het
Trip4	C	A	9: 65,858,340	G359V	probably damaging	Het
Tsr1	T	C	11: 74,900,356	F254L	probably benign	Het
Vmn1r120	T	C	7: 21,053,631	K52E	probably benign	Het
Vmn1r29	C	A	6: 58,307,707	Y137*	probably null	Het
Vmn2r52	T	C	7: 10,159,488	K575E	probably damaging	Het
Wdr95	A	G	5: 149,552,426	Y63C	probably damaging	Het

Other mutations in Med1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00556:Med1	APN	11	98155684	intron	probably benign
IGL00690:Med1	APN	11	98169400	missense	possibly damaging	0.94
IGL01087:Med1	APN	11	98180285	missense	probably damaging	1.00
IGL01133:Med1	APN	11	98157986	nonsense	probably null
IGL02223:Med1	APN	11	98157876	missense	probably damaging	1.00
IGL02257:Med1	APN	11	98180270	missense	probably damaging	0.98
IGL02699:Med1	APN	11	98180025	missense	possibly damaging	0.61
IGL02706:Med1	APN	11	98156707	intron	probably benign
IGL02902:Med1	APN	11	98156509	intron	probably benign
IGL02986:Med1	APN	11	98156260	intron	probably benign
IGL03011:Med1	APN	11	98161033	missense	possibly damaging	0.92
IGL03282:Med1	APN	11	98156817	missense	probably damaging	1.00
IGL03303:Med1	APN	11	98158352	missense	probably damaging	1.00
IGL03342:Med1	APN	11	98189180	critical splice donor site	probably null
IGL03410:Med1	APN	11	98189183	missense	possibly damaging	0.62
PIT4453001:Med1	UTSW	11	98158417	missense	probably benign	0.40
R0040:Med1	UTSW	11	98166255	critical splice donor site	probably null
R0206:Med1	UTSW	11	98155689	intron	probably benign
R0206:Med1	UTSW	11	98155689	intron	probably benign
R0208:Med1	UTSW	11	98155689	intron	probably benign
R0310:Med1	UTSW	11	98167574	missense	probably benign	0.38
R0505:Med1	UTSW	11	98156904	missense	probably damaging	1.00
R0597:Med1	UTSW	11	98169438	missense	probably benign	0.08
R0680:Med1	UTSW	11	98180166	intron	probably null
R0686:Med1	UTSW	11	98158404	missense	probably damaging	1.00
R0698:Med1	UTSW	11	98155689	intron	probably benign
R1293:Med1	UTSW	11	98157036	missense	possibly damaging	0.93
R1302:Med1	UTSW	11	98157449	missense	possibly damaging	0.50
R1365:Med1	UTSW	11	98155995	intron	probably benign
R1537:Med1	UTSW	11	98160946	missense	probably damaging	0.97
R1609:Med1	UTSW	11	98161170	missense	possibly damaging	0.91
R1631:Med1	UTSW	11	98155626	intron	probably benign
R1792:Med1	UTSW	11	98157283	missense	probably damaging	1.00
R1837:Med1	UTSW	11	98169412	missense	probably damaging	1.00
R2366:Med1	UTSW	11	98161182	missense	probably damaging	0.98
R3754:Med1	UTSW	11	98166722	missense	possibly damaging	0.77
R3762:Med1	UTSW	11	98155515	intron	probably benign
R4012:Med1	UTSW	11	98171706	missense	possibly damaging	0.85
R4112:Med1	UTSW	11	98180087	missense	probably damaging	1.00
R4384:Med1	UTSW	11	98152862	unclassified	probably benign
R4579:Med1	UTSW	11	98158422	missense	possibly damaging	0.56
R4740:Med1	UTSW	11	98180264	nonsense	probably null
R4819:Med1	UTSW	11	98155432	intron	probably benign
R4879:Med1	UTSW	11	98155360	unclassified	probably benign
R4993:Med1	UTSW	11	98163904	missense	probably damaging	1.00
R5040:Med1	UTSW	11	98155404	intron	probably benign
R5249:Med1	UTSW	11	98157240	missense	probably benign	0.43
R5373:Med1	UTSW	11	98163963	missense	probably damaging	0.99
R5374:Med1	UTSW	11	98163963	missense	probably damaging	0.99
R5552:Med1	UTSW	11	98166331	nonsense	probably null
R5692:Med1	UTSW	11	98156380	intron	probably benign
R6010:Med1	UTSW	11	98158362	missense	probably damaging	1.00
R6149:Med1	UTSW	11	98183853	missense	possibly damaging	0.74
R6417:Med1	UTSW	11	98157228	missense	probably damaging	0.97
R7301:Med1	UTSW	11	98152808	missense	probably benign	0.23
R7507:Med1	UTSW	11	98158026	missense	probably damaging	1.00
R7529:Med1	UTSW	11	98155965	missense	unknown
R7588:Med1	UTSW	11	98155572	missense	unknown
R7654:Med1	UTSW	11	98169363	missense	possibly damaging	0.75
R7662:Med1	UTSW	11	98155392	missense	unknown
R7679:Med1	UTSW	11	98156061	missense	unknown
R7862:Med1	UTSW	11	98161210	missense	probably benign	0.05
R7945:Med1	UTSW	11	98161210	missense	probably benign	0.05
Z1176:Med1	UTSW	11	98161183	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- GCTTGCCTTGAGGTTTCATC -3'
(R):5'- GTTCAGGACGATCTCAGACG -3'

Sequencing Primer
(F):5'- ATCTTGGTACTGCTGGACCCAC -3'
(R):5'- CATTCCCAAGATTACCATTCAGATTC -3'

Posted On

2014-06-23