Incidental Mutation 'R1831:Fkbp10'
ID207351
Institutional Source Beutler Lab
Gene Symbol Fkbp10
Ensembl Gene ENSMUSG00000001555
Gene NameFK506 binding protein 10
SynonymsFkbp6, Fkbp-rs1, Fkbp1-rs, FKBP65, 65kDa
MMRRC Submission 039858-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1831 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location100415697-100424824 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100423219 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 351 (E351G)
Ref Sequence ENSEMBL: ENSMUSP00000103023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001595] [ENSMUST00000107398] [ENSMUST00000107399] [ENSMUST00000107400]
Predicted Effect probably damaging
Transcript: ENSMUST00000001595
AA Change: E463G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001595
Gene: ENSMUSG00000001555
AA Change: E463G

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:FKBP_C 54 146 5.4e-30 PFAM
Pfam:FKBP_C 166 258 4e-29 PFAM
Pfam:FKBP_C 278 370 2.3e-28 PFAM
Pfam:FKBP_C 391 482 6.2e-26 PFAM
EFh 503 528 2.16e0 SMART
EFh 545 573 2.04e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107398
SMART Domains Protein: ENSMUSP00000103021
Gene: ENSMUSG00000017176

DomainStartEndE-ValueType
Pfam:UMPH-1 44 261 3.5e-108 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107399
SMART Domains Protein: ENSMUSP00000103022
Gene: ENSMUSG00000017176

DomainStartEndE-ValueType
Pfam:UMPH-1 44 261 3.5e-108 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107400
AA Change: E351G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103023
Gene: ENSMUSG00000001555
AA Change: E351G

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:FKBP_C 54 146 1.4e-29 PFAM
Pfam:FKBP_C 166 258 2e-29 PFAM
Pfam:FKBP_C 279 370 4.9e-26 PFAM
EFh 391 416 2.16e0 SMART
EFh 433 461 2.04e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125616
Predicted Effect probably benign
Transcript: ENSMUST00000134815
SMART Domains Protein: ENSMUSP00000123577
Gene: ENSMUSG00000001555

DomainStartEndE-ValueType
Pfam:FKBP_C 34 65 1.6e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139084
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the FKBP-type peptidyl-prolyl cis/trans isomerase (PPIase) family. This protein localizes to the endoplasmic reticulum and acts as a molecular chaperone. Alternatively spliced variants encoding different isoforms have been reported, but their biological validity has not been determined.[provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous null mice do not survive birth, and embryos exhibit delayed growth, tissue fragility, decreased aorta wall thickness, craniofacial and forelimb anomalies, and connective tissue alterations. Mutant MEFs retain procollagen in the cell layer and show dilated endoplasmic reticulum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700109H08Rik A G 5: 3,577,255 D77G probably damaging Het
Adam1b A G 5: 121,502,937 I15T possibly damaging Het
Arfgef1 G C 1: 10,204,890 I312M probably benign Het
Capn8 G A 1: 182,611,101 probably null Het
Carmil1 A T 13: 24,164,879 V15E probably benign Het
Ccdc42 T A 11: 68,590,979 M133K probably benign Het
Cd5 T C 19: 10,719,569 D485G probably damaging Het
Cep104 T A 4: 154,002,546 V842E probably benign Het
Cep162 T A 9: 87,206,932 I966L probably damaging Het
Cklf T C 8: 104,251,055 F13S probably damaging Het
Csf2rb C T 15: 78,348,253 P587S probably benign Het
Cyp21a1 A T 17: 34,804,035 probably benign Het
Cyp26a1 A T 19: 37,700,623 L335F probably damaging Het
Dcst1 A G 3: 89,352,750 F596L probably damaging Het
Dennd6a T A 14: 26,606,954 L44H probably damaging Het
Dnah6 G A 6: 73,181,797 R608C possibly damaging Het
Dnajb5 A T 4: 42,957,333 T311S probably benign Het
Dthd1 A G 5: 62,827,229 T426A probably benign Het
Dync1h1 A G 12: 110,614,059 K118R probably damaging Het
Efemp1 A T 11: 28,921,442 D347V possibly damaging Het
Ephb4 T A 5: 137,354,415 Y87N probably damaging Het
Ern1 A T 11: 106,399,842 probably null Het
Fam184a A T 10: 53,647,084 D164E probably damaging Het
Fmn2 A G 1: 174,609,945 S1161G probably benign Het
Frem1 A G 4: 83,020,837 S3P possibly damaging Het
Gm10260 A G 13: 97,760,545 V15A probably benign Het
Gm281 A G 14: 13,899,619 I101T probably damaging Het
Gpr3 C T 4: 133,211,143 A73T possibly damaging Het
Gprc6a T C 10: 51,615,806 T616A probably benign Het
Gtf3c2 G T 5: 31,168,369 Q452K probably damaging Het
H2-Q7 C A 17: 35,439,699 S104R probably benign Het
Hacd2 T C 16: 35,102,064 Y208H probably damaging Het
Hid1 C T 11: 115,348,903 G734R probably damaging Het
Ifi207 A G 1: 173,732,426 I160T unknown Het
Itga11 T A 9: 62,782,018 L1155Q probably damaging Het
Kmt2d A G 15: 98,855,343 S157P probably damaging Het
Lamb3 A G 1: 193,334,879 T793A probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrrc66 G A 5: 73,607,426 S758L possibly damaging Het
Ltn1 C T 16: 87,400,146 S1213N possibly damaging Het
Med1 T C 11: 98,156,611 probably benign Het
Megf6 C T 4: 154,270,677 T1483M probably benign Het
Micall2 A G 5: 139,716,753 V245A probably benign Het
Mipep T G 14: 60,872,063 Y630D probably damaging Het
Ndst3 T A 3: 123,601,478 H501L probably benign Het
Nek10 A T 14: 14,842,789 M165L probably benign Het
Nmbr C A 10: 14,766,865 T56K probably benign Het
Nxpe2 T A 9: 48,326,152 M268L probably benign Het
Oasl2 A G 5: 114,901,306 Y185C probably benign Het
Ogdhl T A 14: 32,337,527 V377E probably damaging Het
Olfr115 G A 17: 37,609,839 S304L possibly damaging Het
Olfr738 T A 14: 50,414,201 probably null Het
Ovgp1 A G 3: 105,985,068 R346G probably benign Het
Parp14 T A 16: 35,858,588 N337Y possibly damaging Het
Pask A C 1: 93,320,769 probably null Het
Pax3 G T 1: 78,132,340 T227K probably damaging Het
Pik3r6 T A 11: 68,544,034 M594K probably benign Het
Pms1 A G 1: 53,207,211 F390L probably benign Het
Polg G A 7: 79,459,770 T433I probably benign Het
Prex1 T C 2: 166,585,101 Y898C probably damaging Het
Ranbp2 T A 10: 58,479,222 C1921* probably null Het
Rif1 T A 2: 52,078,495 L230* probably null Het
Rnf148 A G 6: 23,654,773 F75L probably damaging Het
Sclt1 A G 3: 41,727,111 V91A probably damaging Het
Sirt1 T C 10: 63,320,646 D735G probably benign Het
Spag5 T A 11: 78,314,256 N622K probably benign Het
Sspo T G 6: 48,489,786 C3935W probably damaging Het
Strbp A G 2: 37,625,265 S250P possibly damaging Het
Tgfbr2 T C 9: 116,090,536 T541A possibly damaging Het
Thada A C 17: 84,231,114 S1489A probably damaging Het
Tiam1 A T 16: 89,860,294 S685T probably benign Het
Tldc1 T C 8: 119,771,253 M171V probably null Het
Tpsb2 T A 17: 25,366,520 probably null Het
Trip4 C A 9: 65,858,340 G359V probably damaging Het
Tsr1 T C 11: 74,900,356 F254L probably benign Het
Vmn1r120 T C 7: 21,053,631 K52E probably benign Het
Vmn1r29 C A 6: 58,307,707 Y137* probably null Het
Vmn2r52 T C 7: 10,159,488 K575E probably damaging Het
Wdr95 A G 5: 149,552,426 Y63C probably damaging Het
Other mutations in Fkbp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00962:Fkbp10 APN 11 100421817 missense probably benign 0.00
IGL02390:Fkbp10 APN 11 100416017 missense probably damaging 1.00
IGL02424:Fkbp10 APN 11 100415956 missense probably damaging 1.00
IGL02728:Fkbp10 APN 11 100415977 missense probably damaging 1.00
IGL02737:Fkbp10 APN 11 100422655 missense probably benign 0.25
IGL03143:Fkbp10 APN 11 100422754 missense probably benign 0.06
R0479:Fkbp10 UTSW 11 100415914 missense probably damaging 1.00
R1733:Fkbp10 UTSW 11 100423931 missense probably benign 0.20
R1817:Fkbp10 UTSW 11 100415889 missense probably benign 0.13
R1819:Fkbp10 UTSW 11 100415889 missense probably benign 0.13
R1997:Fkbp10 UTSW 11 100416015 missense probably damaging 1.00
R2017:Fkbp10 UTSW 11 100421673 missense possibly damaging 0.77
R3758:Fkbp10 UTSW 11 100422625 critical splice acceptor site probably null
R5163:Fkbp10 UTSW 11 100423099 missense probably benign 0.03
R5437:Fkbp10 UTSW 11 100421023 missense probably damaging 1.00
R5666:Fkbp10 UTSW 11 100423526 missense probably damaging 1.00
R5696:Fkbp10 UTSW 11 100423526 missense probably damaging 1.00
R5698:Fkbp10 UTSW 11 100423526 missense probably damaging 1.00
R5706:Fkbp10 UTSW 11 100421023 missense probably damaging 1.00
R7084:Fkbp10 UTSW 11 100421303 missense possibly damaging 0.56
R7405:Fkbp10 UTSW 11 100415881 missense probably damaging 1.00
R7780:Fkbp10 UTSW 11 100421222 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGAAGTGAGAACTGCCATTC -3'
(R):5'- TTTGAAGCTGAGCCCTAACG -3'

Sequencing Primer
(F):5'- TACTGAAAGAGACGAGCCTTCAGTC -3'
(R):5'- AACGCAGGCCTCCGTTTTC -3'
Posted On2014-06-23