Incidental Mutation 'R0115:Tmub2'
ID20736
Institutional Source Beutler Lab
Gene Symbol Tmub2
Ensembl Gene ENSMUSG00000034757
Gene Nametransmembrane and ubiquitin-like domain containing 2
Synonyms
MMRRC Submission 038401-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0115 (G1)
Quality Score225
Status Validated (trace)
Chromosome11
Chromosomal Location102284931-102289237 bp(+) (GRCm38)
Type of Mutationunclassified (925 bp from exon)
DNA Base Change (assembly) T to C at 102288375 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000036376] [ENSMUST00000073234] [ENSMUST00000107132] [ENSMUST00000107134] [ENSMUST00000137387] [ENSMUST00000156326]
Predicted Effect probably benign
Transcript: ENSMUST00000036376
AA Change: I300T

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000047600
Gene: ENSMUSG00000034757
AA Change: I300T

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
UBQ 173 242 1.75e-9 SMART
transmembrane domain 264 286 N/A INTRINSIC
transmembrane domain 296 318 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000073234
SMART Domains Protein: ENSMUSP00000072967
Gene: ENSMUSG00000059995

DomainStartEndE-ValueType
Pfam:Sgf11 80 112 1.3e-21 PFAM
low complexity region 135 143 N/A INTRINSIC
low complexity region 150 159 N/A INTRINSIC
Pfam:SCA7 202 239 8.8e-10 PFAM
low complexity region 275 288 N/A INTRINSIC
low complexity region 302 316 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100387
AA Change: I338T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097956
Gene: ENSMUSG00000034757
AA Change: I338T

DomainStartEndE-ValueType
low complexity region 21 35 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
UBQ 212 281 1.75e-9 SMART
transmembrane domain 303 325 N/A INTRINSIC
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107132
SMART Domains Protein: ENSMUSP00000102750
Gene: ENSMUSG00000059995

DomainStartEndE-ValueType
Pfam:Sgf11 80 112 1.1e-21 PFAM
low complexity region 135 143 N/A INTRINSIC
low complexity region 150 159 N/A INTRINSIC
Pfam:SCA7 209 246 7.8e-11 PFAM
low complexity region 282 295 N/A INTRINSIC
low complexity region 309 323 N/A INTRINSIC
low complexity region 335 345 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107134
SMART Domains Protein: ENSMUSP00000102752
Gene: ENSMUSG00000059995

DomainStartEndE-ValueType
Pfam:Sgf11 80 112 1.3e-21 PFAM
low complexity region 135 143 N/A INTRINSIC
low complexity region 150 159 N/A INTRINSIC
Pfam:SCA7 202 239 8.8e-10 PFAM
low complexity region 275 288 N/A INTRINSIC
low complexity region 302 316 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135551
Predicted Effect probably null
Transcript: ENSMUST00000137387
SMART Domains Protein: ENSMUSP00000122610
Gene: ENSMUSG00000059995

DomainStartEndE-ValueType
Pfam:Sgf11 76 108 2.6e-21 PFAM
low complexity region 131 139 N/A INTRINSIC
low complexity region 146 155 N/A INTRINSIC
Pfam:SCA7 205 242 1.9e-9 PFAM
low complexity region 278 291 N/A INTRINSIC
low complexity region 305 319 N/A INTRINSIC
low complexity region 331 341 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000141516
SMART Domains Protein: ENSMUSP00000121917
Gene: ENSMUSG00000059995

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 27 35 N/A INTRINSIC
low complexity region 42 51 N/A INTRINSIC
Pfam:SCA7 113 150 6.7e-11 PFAM
low complexity region 186 199 N/A INTRINSIC
low complexity region 213 227 N/A INTRINSIC
low complexity region 239 249 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156077
Predicted Effect probably benign
Transcript: ENSMUST00000156326
AA Change: I300T

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000116327
Gene: ENSMUSG00000034757
AA Change: I300T

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
UBQ 173 242 1.75e-9 SMART
transmembrane domain 264 286 N/A INTRINSIC
transmembrane domain 296 318 N/A INTRINSIC
Meta Mutation Damage Score 0.1089 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.2%
  • 20x: 86.0%
Validation Efficiency 98% (98/100)
MGI Phenotype FUNCTION: This gene encodes a predicted multi-pass membrane protein that features a C-terminal ubiquitin-related domain. This gene may be expressed in cone photoreceptors in the retina. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik G A 18: 57,594,142 probably benign Het
2310007B03Rik A T 1: 93,159,725 S135R possibly damaging Het
4921528I07Rik A G 9: 114,279,384 noncoding transcript Het
Alas1 A T 9: 106,238,252 probably null Het
Arf5 A G 6: 28,426,076 Y154C probably damaging Het
Arhgap20 T A 9: 51,838,972 I344N probably damaging Het
Arhgap30 A C 1: 171,407,948 E630A possibly damaging Het
B4galt5 A G 2: 167,309,234 L118P probably damaging Het
Bdp1 A G 13: 100,041,454 I1969T probably benign Het
Bysl C T 17: 47,610,942 R77Q probably benign Het
Cap1 A T 4: 122,863,075 H272Q possibly damaging Het
Ccdc146 T C 5: 21,322,756 I187M possibly damaging Het
Cdk13 C A 13: 17,719,494 A1123S probably damaging Het
Ces5a A T 8: 93,502,183 M473K probably damaging Het
Chd8 A G 14: 52,237,206 S123P probably benign Het
Cwc22 G A 2: 77,908,111 A497V probably damaging Het
Cwh43 T C 5: 73,418,027 S296P probably damaging Het
Cyp2c50 T A 19: 40,092,393 probably benign Het
Dlg1 C A 16: 31,805,690 Y399* probably null Het
Drosha A T 15: 12,846,130 E92D probably benign Het
Fanca C T 8: 123,268,539 G1408D probably benign Het
Frem1 T A 4: 82,936,169 D1621V possibly damaging Het
Frem2 G A 3: 53,656,208 R293C probably damaging Het
Fut8 T A 12: 77,448,560 V308D probably damaging Het
Glipr1 A G 10: 111,993,541 I105T probably benign Het
Glmn A T 5: 107,560,934 S385T probably benign Het
Gm281 A G 14: 13,899,571 V117A probably damaging Het
Gon4l T A 3: 88,895,682 V1200D probably damaging Het
Gpc1 G A 1: 92,857,499 D387N probably damaging Het
Gsdmc A G 15: 63,803,637 Y110H probably damaging Het
Gucy1b1 T A 3: 82,034,391 H586L probably benign Het
Gucy2e A G 11: 69,236,632 L5P unknown Het
Hectd4 A G 5: 121,295,506 probably benign Het
Hmcn1 T A 1: 150,808,647 I391F possibly damaging Het
Hsf4 A T 8: 105,272,704 probably null Het
I830077J02Rik G A 3: 105,926,570 T90M probably damaging Het
Ino80 A T 2: 119,431,016 H722Q probably damaging Het
Kcnma1 C A 14: 23,314,175 R980L probably damaging Het
Kif1a A G 1: 93,046,778 probably benign Het
Klhdc7b A G 15: 89,388,521 H1202R probably benign Het
Lig3 A G 11: 82,793,935 D559G probably damaging Het
Lyst T C 13: 13,677,952 V2179A probably benign Het
Mansc4 A G 6: 147,075,227 I297T possibly damaging Het
March6 A T 15: 31,475,812 F633I probably benign Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Megf10 G T 18: 57,259,802 V424L possibly damaging Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mib2 A G 4: 155,656,062 probably benign Het
Mut C T 17: 40,956,227 T564M probably damaging Het
Myh8 A G 11: 67,306,264 probably benign Het
Mypn T C 10: 63,192,380 probably benign Het
Nf1 G A 11: 79,468,876 probably null Het
Notch3 T A 17: 32,133,462 T1866S possibly damaging Het
Olfr108 C T 17: 37,445,779 A86V probably benign Het
Olfr1189 A T 2: 88,592,655 I284F probably damaging Het
Olfr1301 T A 2: 111,754,585 M112K probably damaging Het
Olfr390 A G 11: 73,787,315 I126V possibly damaging Het
Pkhd1 A T 1: 20,350,490 I2464N probably damaging Het
Pkn1 A G 8: 83,671,029 S817P probably damaging Het
Prkg2 A T 5: 98,994,655 probably null Het
Prl8a6 T C 13: 27,433,101 D201G probably benign Het
Psmd1 C T 1: 86,083,271 T356I possibly damaging Het
Ptk6 G A 2: 181,202,527 probably benign Het
Ptprn2 T C 12: 117,211,846 probably benign Het
Rbm42 G A 7: 30,647,775 T106I probably damaging Het
Rims4 A T 2: 163,864,120 V198E probably damaging Het
Ripk1 T C 13: 34,009,750 S32P probably damaging Het
Rorc T C 3: 94,377,609 probably benign Het
Rpl22l1 T C 3: 28,806,536 F15L probably damaging Het
Slc6a20a C A 9: 123,678,758 A17S possibly damaging Het
Sorcs1 A G 19: 50,636,453 probably benign Het
Sp100 A G 1: 85,650,131 probably benign Het
Ssc5d G A 7: 4,927,881 probably benign Het
Taf11 A G 17: 27,907,661 L4P probably benign Het
Tm2d3 A G 7: 65,695,334 probably benign Het
Trim34a T A 7: 104,247,902 C58S probably damaging Het
Trpc3 T C 3: 36,624,417 I840V probably benign Het
Trpm6 T C 19: 18,829,952 V1020A probably damaging Het
Vmn1r214 T A 13: 23,035,294 Y319* probably null Het
Vmn1r59 T C 7: 5,454,116 N215S probably benign Het
Vmn2r74 T C 7: 85,957,356 M261V probably benign Het
Vmn2r89 T C 14: 51,456,120 F309S probably damaging Het
Wdr95 A T 5: 149,564,390 D163V probably damaging Het
Xirp2 T A 2: 67,509,909 F831L possibly damaging Het
Ythdc2 C T 18: 44,841,423 probably benign Het
Other mutations in Tmub2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0332:Tmub2 UTSW 11 102288348 missense probably damaging 1.00
R1168:Tmub2 UTSW 11 102287370 missense possibly damaging 0.77
R1530:Tmub2 UTSW 11 102287486 missense probably benign 0.01
R2141:Tmub2 UTSW 11 102287553 missense possibly damaging 0.89
R2420:Tmub2 UTSW 11 102287755 missense probably benign
R2421:Tmub2 UTSW 11 102287755 missense probably benign
R3717:Tmub2 UTSW 11 102285061 unclassified probably benign
R4660:Tmub2 UTSW 11 102285019 unclassified probably benign
R5238:Tmub2 UTSW 11 102284994 unclassified probably benign
R5444:Tmub2 UTSW 11 102288240 missense possibly damaging 0.80
R6590:Tmub2 UTSW 11 102287519 missense probably damaging 1.00
R6690:Tmub2 UTSW 11 102287519 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGACAAGAGAGCCAAATGAAGT -3'
(R):5'- ACCTGAGTTGTGCTTGCAGAGAT -3'

Sequencing Primer
(F):5'- AGTTGATCTACCAGGGTCGG -3'
(R):5'- GATATCTGTACCCTCTGGAC -3'
Posted On2013-04-11