Incidental Mutation 'R0115:Ptprn2'
ID 20738
Institutional Source Beutler Lab
Gene Symbol Ptprn2
Ensembl Gene ENSMUSG00000056553
Gene Name protein tyrosine phosphatase receptor type N polypeptide 2
Synonyms IA-2 beta, PTP-NP, 4930425H11Rik, IA-2beta, phogrin
MMRRC Submission 038401-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.170) question?
Stock # R0115 (G1)
Quality Score 161
Status Validated (trace)
Chromosome 12
Chromosomal Location 116449340-117240469 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 117175466 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070733] [ENSMUST00000190247]
AlphaFold P80560
Predicted Effect probably benign
Transcript: ENSMUST00000070733
SMART Domains Protein: ENSMUSP00000064046
Gene: ENSMUSG00000056553

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 495 583 1.5e-35 PFAM
low complexity region 687 707 N/A INTRINSIC
PTPc 730 993 4.42e-119 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190247
SMART Domains Protein: ENSMUSP00000139978
Gene: ENSMUSG00000056553

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 494 584 2.5e-43 PFAM
transmembrane domain 602 624 N/A INTRINSIC
low complexity region 687 707 N/A INTRINSIC
PTPc 730 932 8.81e-64 SMART
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.2%
  • 20x: 86.0%
Validation Efficiency 98% (98/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to receptor-like protein tyrosine phosphatases. However, tyrosine phosphatase activity has not been experimentally validated for this protein. Studies of the rat ortholog suggest that the encoded protein may instead function as a phosphatidylinositol phosphatase with the ability to dephosphorylate phosphatidylinositol 3-phosphate and phosphatidylinositol 4,5-diphosphate, and this function may be involved in the regulation of insulin secretion. This protein has been identified as an autoantigen in insulin-dependent diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Homozygous null mice display impaired glucose tolerance but normal fasting and non-fasting blood glucose and insulin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik A G 9: 114,108,452 (GRCm39) noncoding transcript Het
Alas1 A T 9: 106,115,451 (GRCm39) probably null Het
Arf5 A G 6: 28,426,075 (GRCm39) Y154C probably damaging Het
Arhgap20 T A 9: 51,750,272 (GRCm39) I344N probably damaging Het
Arhgap30 A C 1: 171,235,516 (GRCm39) E630A possibly damaging Het
B4galt5 A G 2: 167,151,154 (GRCm39) L118P probably damaging Het
Bdp1 A G 13: 100,177,962 (GRCm39) I1969T probably benign Het
Bysl C T 17: 47,921,867 (GRCm39) R77Q probably benign Het
Cap1 A T 4: 122,756,868 (GRCm39) H272Q possibly damaging Het
Ccdc146 T C 5: 21,527,754 (GRCm39) I187M possibly damaging Het
Ccdc192 G A 18: 57,727,214 (GRCm39) probably benign Het
Cdhr18 A G 14: 13,899,571 (GRCm38) V117A probably damaging Het
Cdk13 C A 13: 17,894,079 (GRCm39) A1123S probably damaging Het
Ces5a A T 8: 94,228,811 (GRCm39) M473K probably damaging Het
Chd8 A G 14: 52,474,663 (GRCm39) S123P probably benign Het
Cwc22 G A 2: 77,738,455 (GRCm39) A497V probably damaging Het
Cwh43 T C 5: 73,575,370 (GRCm39) S296P probably damaging Het
Cyp2c50 T A 19: 40,080,837 (GRCm39) probably benign Het
Dlg1 C A 16: 31,624,508 (GRCm39) Y399* probably null Het
Drosha A T 15: 12,846,216 (GRCm39) E92D probably benign Het
Fanca C T 8: 123,995,278 (GRCm39) G1408D probably benign Het
Frem1 T A 4: 82,854,406 (GRCm39) D1621V possibly damaging Het
Frem2 G A 3: 53,563,629 (GRCm39) R293C probably damaging Het
Fut8 T A 12: 77,495,334 (GRCm39) V308D probably damaging Het
Glipr1 A G 10: 111,829,446 (GRCm39) I105T probably benign Het
Glmn A T 5: 107,708,800 (GRCm39) S385T probably benign Het
Gon4l T A 3: 88,802,989 (GRCm39) V1200D probably damaging Het
Gpc1 G A 1: 92,785,221 (GRCm39) D387N probably damaging Het
Gsdmc A G 15: 63,675,486 (GRCm39) Y110H probably damaging Het
Gucy1b1 T A 3: 81,941,698 (GRCm39) H586L probably benign Het
Gucy2e A G 11: 69,127,458 (GRCm39) L5P unknown Het
Hectd4 A G 5: 121,433,569 (GRCm39) probably benign Het
Hmcn1 T A 1: 150,684,398 (GRCm39) I391F possibly damaging Het
Hsf4 A T 8: 105,999,336 (GRCm39) probably null Het
I830077J02Rik G A 3: 105,833,886 (GRCm39) T90M probably damaging Het
Ino80 A T 2: 119,261,497 (GRCm39) H722Q probably damaging Het
Kcnma1 C A 14: 23,364,243 (GRCm39) R980L probably damaging Het
Kif1a A G 1: 92,974,500 (GRCm39) probably benign Het
Klhdc7b A G 15: 89,272,724 (GRCm39) H1202R probably benign Het
Lig3 A G 11: 82,684,761 (GRCm39) D559G probably damaging Het
Lyst T C 13: 13,852,537 (GRCm39) V2179A probably benign Het
Mab21l4 A T 1: 93,087,447 (GRCm39) S135R possibly damaging Het
Mansc4 A G 6: 146,976,725 (GRCm39) I297T possibly damaging Het
Marchf6 A T 15: 31,475,958 (GRCm39) F633I probably benign Het
Marf1 C T 16: 13,960,398 (GRCm39) A549T probably damaging Het
Megf10 G T 18: 57,392,874 (GRCm39) V424L possibly damaging Het
Mfsd13a C T 19: 46,354,943 (GRCm39) T40I probably benign Het
Mib2 A G 4: 155,740,519 (GRCm39) probably benign Het
Mmut C T 17: 41,267,118 (GRCm39) T564M probably damaging Het
Myh8 A G 11: 67,197,090 (GRCm39) probably benign Het
Mypn T C 10: 63,028,159 (GRCm39) probably benign Het
Nf1 G A 11: 79,359,702 (GRCm39) probably null Het
Notch3 T A 17: 32,352,436 (GRCm39) T1866S possibly damaging Het
Or1e30 A G 11: 73,678,141 (GRCm39) I126V possibly damaging Het
Or1o11 C T 17: 37,756,670 (GRCm39) A86V probably benign Het
Or4c102 A T 2: 88,422,999 (GRCm39) I284F probably damaging Het
Or4k51 T A 2: 111,584,930 (GRCm39) M112K probably damaging Het
Pkhd1 A T 1: 20,420,714 (GRCm39) I2464N probably damaging Het
Pkn1 A G 8: 84,397,658 (GRCm39) S817P probably damaging Het
Prkg2 A T 5: 99,142,514 (GRCm39) probably null Het
Prl8a6 T C 13: 27,617,084 (GRCm39) D201G probably benign Het
Psmd1 C T 1: 86,010,993 (GRCm39) T356I possibly damaging Het
Ptk6 G A 2: 180,844,320 (GRCm39) probably benign Het
Rbm42 G A 7: 30,347,200 (GRCm39) T106I probably damaging Het
Rims4 A T 2: 163,706,040 (GRCm39) V198E probably damaging Het
Ripk1 T C 13: 34,193,733 (GRCm39) S32P probably damaging Het
Rorc T C 3: 94,284,916 (GRCm39) probably benign Het
Rpl22l1 T C 3: 28,860,685 (GRCm39) F15L probably damaging Het
Slc6a20a C A 9: 123,507,823 (GRCm39) A17S possibly damaging Het
Sorcs1 A G 19: 50,624,891 (GRCm39) probably benign Het
Sp100 A G 1: 85,577,852 (GRCm39) probably benign Het
Ssc5d G A 7: 4,930,880 (GRCm39) probably benign Het
Taf11 A G 17: 28,126,635 (GRCm39) L4P probably benign Het
Tm2d3 A G 7: 65,345,082 (GRCm39) probably benign Het
Tmub2 T C 11: 102,179,201 (GRCm39) probably null Het
Trim34a T A 7: 103,897,109 (GRCm39) C58S probably damaging Het
Trpc3 T C 3: 36,678,566 (GRCm39) I840V probably benign Het
Trpm6 T C 19: 18,807,316 (GRCm39) V1020A probably damaging Het
Vmn1r214 T A 13: 23,219,464 (GRCm39) Y319* probably null Het
Vmn1r59 T C 7: 5,457,115 (GRCm39) N215S probably benign Het
Vmn2r74 T C 7: 85,606,564 (GRCm39) M261V probably benign Het
Vmn2r89 T C 14: 51,693,577 (GRCm39) F309S probably damaging Het
Wdr95 A T 5: 149,487,855 (GRCm39) D163V probably damaging Het
Xirp2 T A 2: 67,340,253 (GRCm39) F831L possibly damaging Het
Ythdc2 C T 18: 44,974,490 (GRCm39) probably benign Het
Other mutations in Ptprn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01695:Ptprn2 APN 12 116,805,008 (GRCm39) missense probably benign 0.02
IGL01788:Ptprn2 APN 12 116,864,607 (GRCm39) missense probably damaging 0.98
IGL02172:Ptprn2 APN 12 116,837,317 (GRCm39) splice site probably benign
IGL02339:Ptprn2 APN 12 116,685,724 (GRCm39) missense probably damaging 1.00
IGL02706:Ptprn2 APN 12 116,852,518 (GRCm39) missense probably damaging 0.96
IGL03018:Ptprn2 APN 12 117,175,563 (GRCm39) missense probably damaging 1.00
IGL03267:Ptprn2 APN 12 116,839,964 (GRCm39) nonsense probably null
BB001:Ptprn2 UTSW 12 116,804,884 (GRCm39) missense probably benign 0.00
BB011:Ptprn2 UTSW 12 116,804,884 (GRCm39) missense probably benign 0.00
IGL03014:Ptprn2 UTSW 12 117,212,308 (GRCm39) missense probably damaging 1.00
R0066:Ptprn2 UTSW 12 117,240,222 (GRCm39) missense probably benign 0.07
R0066:Ptprn2 UTSW 12 117,240,222 (GRCm39) missense probably benign 0.07
R0131:Ptprn2 UTSW 12 116,685,711 (GRCm39) missense probably damaging 1.00
R0131:Ptprn2 UTSW 12 116,685,711 (GRCm39) missense probably damaging 1.00
R0132:Ptprn2 UTSW 12 116,685,711 (GRCm39) missense probably damaging 1.00
R0481:Ptprn2 UTSW 12 117,175,466 (GRCm39) splice site probably benign
R0694:Ptprn2 UTSW 12 116,787,975 (GRCm39) missense possibly damaging 0.69
R0698:Ptprn2 UTSW 12 116,685,750 (GRCm39) nonsense probably null
R0746:Ptprn2 UTSW 12 116,864,637 (GRCm39) missense probably benign 0.00
R1127:Ptprn2 UTSW 12 117,175,628 (GRCm39) splice site probably null
R1443:Ptprn2 UTSW 12 117,217,235 (GRCm39) missense probably damaging 1.00
R1508:Ptprn2 UTSW 12 117,148,342 (GRCm39) missense probably damaging 1.00
R1664:Ptprn2 UTSW 12 117,125,329 (GRCm39) missense probably damaging 0.99
R1670:Ptprn2 UTSW 12 116,685,792 (GRCm39) missense possibly damaging 0.64
R1749:Ptprn2 UTSW 12 116,544,048 (GRCm39) missense probably benign 0.00
R2075:Ptprn2 UTSW 12 117,211,337 (GRCm39) missense probably benign 0.01
R3054:Ptprn2 UTSW 12 116,685,753 (GRCm39) missense probably damaging 1.00
R3107:Ptprn2 UTSW 12 116,839,800 (GRCm39) missense probably benign 0.04
R3109:Ptprn2 UTSW 12 116,839,800 (GRCm39) missense probably benign 0.04
R3552:Ptprn2 UTSW 12 116,852,497 (GRCm39) missense probably benign 0.00
R4193:Ptprn2 UTSW 12 116,864,628 (GRCm39) missense probably benign 0.01
R4523:Ptprn2 UTSW 12 116,839,620 (GRCm39) missense probably damaging 1.00
R4706:Ptprn2 UTSW 12 116,835,714 (GRCm39) missense probably benign 0.02
R4719:Ptprn2 UTSW 12 116,788,016 (GRCm39) missense possibly damaging 0.95
R4726:Ptprn2 UTSW 12 117,211,393 (GRCm39) nonsense probably null
R4872:Ptprn2 UTSW 12 117,125,314 (GRCm39) missense probably damaging 1.00
R4891:Ptprn2 UTSW 12 117,196,985 (GRCm39) splice site probably null
R4970:Ptprn2 UTSW 12 117,240,215 (GRCm39) missense probably damaging 1.00
R5208:Ptprn2 UTSW 12 116,822,548 (GRCm39) missense probably damaging 1.00
R5287:Ptprn2 UTSW 12 117,175,482 (GRCm39) missense probably damaging 1.00
R5419:Ptprn2 UTSW 12 117,148,267 (GRCm39) missense probably damaging 0.99
R6035:Ptprn2 UTSW 12 117,219,215 (GRCm39) missense probably damaging 1.00
R6035:Ptprn2 UTSW 12 117,219,215 (GRCm39) missense probably damaging 1.00
R6180:Ptprn2 UTSW 12 116,822,739 (GRCm39) missense probably benign 0.05
R6277:Ptprn2 UTSW 12 116,839,800 (GRCm39) missense probably benign 0.04
R6465:Ptprn2 UTSW 12 117,233,209 (GRCm39) missense probably damaging 0.96
R6488:Ptprn2 UTSW 12 116,835,658 (GRCm39) missense probably benign 0.13
R6555:Ptprn2 UTSW 12 117,190,820 (GRCm39) missense probably damaging 1.00
R6908:Ptprn2 UTSW 12 116,852,508 (GRCm39) missense probably benign 0.06
R7120:Ptprn2 UTSW 12 116,835,676 (GRCm39) missense probably benign 0.01
R7229:Ptprn2 UTSW 12 117,190,845 (GRCm39) splice site probably null
R7237:Ptprn2 UTSW 12 117,125,347 (GRCm39) missense probably benign 0.03
R7304:Ptprn2 UTSW 12 117,212,164 (GRCm39) missense probably damaging 1.00
R7355:Ptprn2 UTSW 12 116,822,571 (GRCm39) missense probably benign
R7460:Ptprn2 UTSW 12 117,212,301 (GRCm39) missense probably benign 0.05
R7577:Ptprn2 UTSW 12 116,449,486 (GRCm39) start codon destroyed probably null
R7658:Ptprn2 UTSW 12 116,685,739 (GRCm39) missense probably benign 0.01
R7666:Ptprn2 UTSW 12 116,804,940 (GRCm39) missense probably benign 0.10
R7924:Ptprn2 UTSW 12 116,804,884 (GRCm39) missense probably benign 0.00
R8219:Ptprn2 UTSW 12 117,148,357 (GRCm39) missense probably benign 0.30
R8716:Ptprn2 UTSW 12 117,219,168 (GRCm39) missense possibly damaging 0.73
R9235:Ptprn2 UTSW 12 117,233,271 (GRCm39) critical splice donor site probably null
R9605:Ptprn2 UTSW 12 117,125,278 (GRCm39) missense probably benign 0.13
X0066:Ptprn2 UTSW 12 117,148,360 (GRCm39) missense probably benign 0.16
X0066:Ptprn2 UTSW 12 117,125,380 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGCCCATGCTCATAAGCTTC -3'
(R):5'- AGTAAATCACAGCCAGGTGTCCCC -3'

Sequencing Primer
(F):5'- GGTGTATATGACACCCCTATAGCAG -3'
(R):5'- GCTAGGTCACCCAAGCTAGATAC -3'
Posted On 2013-04-11