Incidental Mutation 'R1843:Scyl3'
ID207388
Institutional Source Beutler Lab
Gene Symbol Scyl3
Ensembl Gene ENSMUSG00000026584
Gene NameSCY1-like 3 (S. cerevisiae)
Synonyms1200016D23Rik, Pace1
MMRRC Submission 039868-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock #R1843 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location163929100-163955126 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 163950675 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 461 (S461G)
Ref Sequence ENSEMBL: ENSMUSP00000132109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027876] [ENSMUST00000045876] [ENSMUST00000097493] [ENSMUST00000159516] [ENSMUST00000159617] [ENSMUST00000161908] [ENSMUST00000162234] [ENSMUST00000170359]
Predicted Effect probably benign
Transcript: ENSMUST00000027876
AA Change: S474G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027876
Gene: ENSMUSG00000026584
AA Change: S474G

DomainStartEndE-ValueType
Pfam:Pkinase 32 245 1.9e-7 PFAM
low complexity region 525 541 N/A INTRINSIC
low complexity region 711 731 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000045876
SMART Domains Protein: ENSMUSP00000043143
Gene: ENSMUSG00000041406

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
Pfam:DUF4487 233 779 2.3e-209 PFAM
low complexity region 877 889 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097493
SMART Domains Protein: ENSMUSP00000095101
Gene: ENSMUSG00000041406

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
Pfam:DUF4487 233 779 1.3e-186 PFAM
low complexity region 877 889 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159516
Predicted Effect probably benign
Transcript: ENSMUST00000159617
Predicted Effect probably benign
Transcript: ENSMUST00000161908
AA Change: S461G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125735
Gene: ENSMUSG00000026584
AA Change: S461G

DomainStartEndE-ValueType
Pfam:Pkinase 25 274 1.5e-8 PFAM
low complexity region 512 528 N/A INTRINSIC
low complexity region 698 718 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162234
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162920
Predicted Effect probably benign
Transcript: ENSMUST00000170359
AA Change: S461G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132109
Gene: ENSMUSG00000026584
AA Change: S461G

DomainStartEndE-ValueType
Pfam:Pkinase 25 274 1.5e-8 PFAM
low complexity region 512 528 N/A INTRINSIC
low complexity region 698 718 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a kinase domain and four HEAT repeats. The encoded protein interacts with the C-terminal domain of ezrin, an ERM protein, and may play a role in cell adhesion and migration. Alternative splicing results in multiple transcript variants encoding multiple isoforms. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik C T 8: 105,708,974 T88M probably damaging Het
9130011E15Rik A C 19: 45,975,252 S42R probably benign Het
9430038I01Rik A G 7: 137,377,066 probably benign Het
Adgra3 A C 5: 49,961,492 S905A probably damaging Het
Adgrv1 A G 13: 81,544,533 Y1618H probably damaging Het
Anapc15-ps T C 10: 95,673,314 T26A probably benign Het
Ankrd13d T C 19: 4,271,595 K360E probably damaging Het
Anks1b T A 10: 90,512,889 probably null Het
Apob T C 12: 8,007,602 F2028S possibly damaging Het
Arap3 G A 18: 37,975,583 R1265W probably damaging Het
Arhgef37 A G 18: 61,518,050 Y135H probably damaging Het
Atp1a1 T C 3: 101,582,017 T760A probably benign Het
Cdc42bpb T A 12: 111,322,821 M497L probably benign Het
Ces5a C T 8: 93,514,231 V413M probably damaging Het
Chd5 A T 4: 152,385,806 Y1903F probably damaging Het
Chd9 T A 8: 91,010,794 N1500K probably benign Het
Chmp7 G T 14: 69,719,799 D303E probably benign Het
Chrnb4 A T 9: 55,034,818 Y391N possibly damaging Het
Crtc1 T C 8: 70,388,152 T475A probably benign Het
Cyp2c69 A G 19: 39,877,528 I207T probably benign Het
Dcp1a A G 14: 30,518,983 E250G probably damaging Het
Ddx20 T C 3: 105,679,082 Q649R probably benign Het
Defb12 T A 8: 19,112,738 K59N probably damaging Het
Dpy19l3 A T 7: 35,729,760 I85N probably damaging Het
Duox2 C T 2: 122,292,258 probably null Het
E430018J23Rik A C 7: 127,391,488 D442E probably benign Het
Ebi3 T A 17: 55,956,679 Y197N probably damaging Het
Emc1 G A 4: 139,375,512 R994Q probably benign Het
Ercc6 G T 14: 32,546,820 M530I probably damaging Het
Evl T A 12: 108,652,996 D70E probably damaging Het
Fam35a A G 14: 34,267,803 I382T probably benign Het
Fbln2 A G 6: 91,265,775 N819S probably damaging Het
Foxk2 A G 11: 121,285,537 I170V probably benign Het
Gfm1 T C 3: 67,435,610 V159A probably damaging Het
Gm10837 A G 14: 122,490,765 T18A unknown Het
Gm12887 A T 4: 121,622,030 V25E probably damaging Het
Hectd4 A G 5: 121,297,180 H985R possibly damaging Het
Hsfy2 A G 1: 56,636,632 Y249H possibly damaging Het
Hspg2 T C 4: 137,545,567 V2639A probably damaging Het
Igf2r A G 17: 12,704,270 probably null Het
Invs T A 4: 48,422,035 I889N probably damaging Het
Kcnq1 A T 7: 143,183,120 M209L probably benign Het
Klra7 A G 6: 130,229,994 I48T possibly damaging Het
Krt26 CTAGTA CTA 11: 99,333,526 probably benign Het
Lrif1 T A 3: 106,732,811 V404D probably damaging Het
Lrriq1 T A 10: 103,227,173 probably null Het
Lypd6 T A 2: 50,188,762 I90N possibly damaging Het
Mbp A G 18: 82,584,122 D174G probably damaging Het
Megf9 G T 4: 70,534,785 P13Q probably damaging Het
Myo15b A T 11: 115,869,586 T1155S probably benign Het
Nlrp6 T A 7: 140,923,093 C371S probably damaging Het
Nosip T A 7: 45,077,309 probably null Het
Nox3 G T 17: 3,669,878 P344H probably damaging Het
Nup210l T C 3: 90,172,086 V959A probably damaging Het
Olfr1360 C A 13: 21,674,672 V91L probably benign Het
Olfr1475 A G 19: 13,479,931 I89T probably benign Het
Olfr175-ps1 T A 16: 58,824,077 I211F probably damaging Het
Olfr267 T C 4: 58,785,384 I113V probably benign Het
Olfr959 A G 9: 39,572,735 Y175H possibly damaging Het
Osbpl3 A C 6: 50,370,143 S25A probably damaging Het
Otog G A 7: 46,246,283 C107Y probably damaging Het
Pax7 G A 4: 139,784,491 R260C probably damaging Het
Pbrm1 A T 14: 31,038,957 I224F probably damaging Het
Pcdh1 T A 18: 38,192,225 probably null Het
Pcnx T C 12: 81,980,935 L1585P probably damaging Het
Pde4c C T 8: 70,747,950 H362Y probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pgm2 A T 4: 99,961,478 Q90L probably damaging Het
Phlpp1 A G 1: 106,343,505 H814R probably benign Het
Pknox2 A T 9: 36,954,831 M5K possibly damaging Het
Pole G A 5: 110,330,835 probably null Het
Polr1b A G 2: 129,102,966 I61V probably benign Het
Prelp T C 1: 133,914,757 K217E probably damaging Het
Prkce C T 17: 86,475,546 Q202* probably null Het
Psmd2 T G 16: 20,656,582 M370R probably benign Het
Rimklb A T 6: 122,464,009 H68Q probably damaging Het
Rnasel A G 1: 153,754,674 D312G possibly damaging Het
Rxrg A T 1: 167,598,752 M1L probably benign Het
Scrn1 A G 6: 54,522,841 F220L possibly damaging Het
Serpina1c T A 12: 103,895,023 T411S probably benign Het
Serpinb6d C T 13: 33,671,381 P346L probably benign Het
Slc9a3r2 C T 17: 24,641,719 S150N possibly damaging Het
Spg21 G T 9: 65,465,336 V17F probably damaging Het
Spink5 A T 18: 43,999,891 M525L probably benign Het
Sun2 T C 15: 79,737,563 T155A probably benign Het
Tchh T A 3: 93,446,780 F1176I unknown Het
Tex15 T A 8: 33,576,654 D2037E probably benign Het
Tfdp2 T C 9: 96,317,804 C392R possibly damaging Het
Tmem30c T C 16: 57,276,780 N139S probably benign Het
Tns2 C T 15: 102,113,133 probably null Het
Trim66 T C 7: 109,475,839 E405G probably damaging Het
Trpc4 T A 3: 54,279,994 F456I probably benign Het
Tspo2 T C 17: 48,448,790 D108G possibly damaging Het
Tyk2 A T 9: 21,121,554 C304* probably null Het
Vgll4 A T 6: 114,862,795 S185T probably benign Het
Vmn2r94 A C 17: 18,244,470 S519R probably benign Het
Vmn2r96 T G 17: 18,597,921 S587A probably benign Het
Vps4b C A 1: 106,778,982 A287S possibly damaging Het
Yeats2 C T 16: 20,229,564 P1332S probably benign Het
Zfp462 T G 4: 55,010,010 S659A possibly damaging Het
Zfp507 C T 7: 35,793,725 R631Q probably damaging Het
Zswim5 G T 4: 116,877,699 E80D unknown Het
Other mutations in Scyl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Scyl3 APN 1 163934769 nonsense probably null
IGL03410:Scyl3 APN 1 163944867 missense probably damaging 1.00
R0017:Scyl3 UTSW 1 163939969 missense possibly damaging 0.53
R0017:Scyl3 UTSW 1 163939969 missense possibly damaging 0.53
R1138:Scyl3 UTSW 1 163933665 missense possibly damaging 0.47
R1363:Scyl3 UTSW 1 163950690 missense probably benign 0.01
R1564:Scyl3 UTSW 1 163939984 critical splice donor site probably null
R1856:Scyl3 UTSW 1 163933696 splice site probably null
R3873:Scyl3 UTSW 1 163950637 missense probably benign 0.00
R4018:Scyl3 UTSW 1 163936499 missense possibly damaging 0.83
R4746:Scyl3 UTSW 1 163949251 missense probably damaging 1.00
R4940:Scyl3 UTSW 1 163934747 missense probably damaging 1.00
R5408:Scyl3 UTSW 1 163954676 utr 3 prime probably null
R6125:Scyl3 UTSW 1 163950576 missense probably benign
R6268:Scyl3 UTSW 1 163946217 nonsense probably null
R6374:Scyl3 UTSW 1 163949214 missense probably benign 0.12
R7397:Scyl3 UTSW 1 163950918 intron probably null
R7489:Scyl3 UTSW 1 163949176 missense possibly damaging 0.94
R7529:Scyl3 UTSW 1 163943869 missense probably damaging 0.99
R7615:Scyl3 UTSW 1 163950338 intron probably null
R8089:Scyl3 UTSW 1 163936427 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TTTAACCTCAGGAGACAGGAAACC -3'
(R):5'- TGTACAATGTGGGAGGATTAGATGC -3'

Sequencing Primer
(F):5'- GATGTTCTTTTATCTGTGCTACATGC -3'
(R):5'- TGCATAACAACTGTTTGGAGAGGTC -3'
Posted On2014-06-23