Mutagenetix > Incidental Mutation

Incidental Mutation 'R1843:Nup210l'

207396

Institutional Source

Beutler Lab

Gene Symbol

Nup210l

Ensembl Gene

ENSMUSG00000027939

Gene Name

nucleoporin 210-like

Synonyms

4930548O11Rik, R26-EGFP, Tg(Gt(ROSA)26Sor-EGFP)130910Eps

MMRRC Submission

039868-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.459) question?

Stock #

R1843 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

90104132-90212048 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 90172086 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 959 (V959A)

Ref Sequence

ENSEMBL: ENSMUSP00000143368 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029548] [ENSMUST00000200410]

AlphaFold

Q9D2F7

Predicted Effect

probably damaging
Transcript: ENSMUST00000029548
AA Change: V959A

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000029548
Gene: ENSMUSG00000027939
AA Change: V959A

Domain	Start	End	E-Value	Type
transmembrane domain	13	32	N/A	INTRINSIC
BID_2	457	536	2.05e1	SMART
Blast:S1	949	1023	2e-16	BLAST
BID_2	1077	1152	4.51e-11	SMART
Blast:BID_2	1468	1550	7e-15	BLAST
transmembrane domain	1807	1829	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000200410
AA Change: V959A

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000143368
Gene: ENSMUSG00000027939
AA Change: V959A

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
BID_2	457	536	6.9e-2	SMART
Blast:S1	938	1023	9e-17	BLAST
BID_2	1077	1152	1.5e-13	SMART
Blast:BID_2	1468	1550	7e-15	BLAST
transmembrane domain	1807	1829	N/A	INTRINSIC

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.3%
20x: 92.4%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a transgene insertion exhibit male infertility, asthenozoospermia, teratozoospermia, azoospermia, and seminiferous tubule degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 102 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933405L10Rik	C	T	8: 105,708,974	T88M	probably damaging	Het
9130011E15Rik	A	C	19: 45,975,252	S42R	probably benign	Het
9430038I01Rik	A	G	7: 137,377,066		probably benign	Het
Adgra3	A	C	5: 49,961,492	S905A	probably damaging	Het
Adgrv1	A	G	13: 81,544,533	Y1618H	probably damaging	Het
Anapc15-ps	T	C	10: 95,673,314	T26A	probably benign	Het
Ankrd13d	T	C	19: 4,271,595	K360E	probably damaging	Het
Anks1b	T	A	10: 90,512,889		probably null	Het
Apob	T	C	12: 8,007,602	F2028S	possibly damaging	Het
Arap3	G	A	18: 37,975,583	R1265W	probably damaging	Het
Arhgef37	A	G	18: 61,518,050	Y135H	probably damaging	Het
Atp1a1	T	C	3: 101,582,017	T760A	probably benign	Het
Cdc42bpb	T	A	12: 111,322,821	M497L	probably benign	Het
Ces5a	C	T	8: 93,514,231	V413M	probably damaging	Het
Chd5	A	T	4: 152,385,806	Y1903F	probably damaging	Het
Chd9	T	A	8: 91,010,794	N1500K	probably benign	Het
Chmp7	G	T	14: 69,719,799	D303E	probably benign	Het
Chrnb4	A	T	9: 55,034,818	Y391N	possibly damaging	Het
Crtc1	T	C	8: 70,388,152	T475A	probably benign	Het
Cyp2c69	A	G	19: 39,877,528	I207T	probably benign	Het
Dcp1a	A	G	14: 30,518,983	E250G	probably damaging	Het
Ddx20	T	C	3: 105,679,082	Q649R	probably benign	Het
Defb12	T	A	8: 19,112,738	K59N	probably damaging	Het
Dpy19l3	A	T	7: 35,729,760	I85N	probably damaging	Het
Duox2	C	T	2: 122,292,258		probably null	Het
E430018J23Rik	A	C	7: 127,391,488	D442E	probably benign	Het
Ebi3	T	A	17: 55,956,679	Y197N	probably damaging	Het
Emc1	G	A	4: 139,375,512	R994Q	probably benign	Het
Ercc6	G	T	14: 32,546,820	M530I	probably damaging	Het
Evl	T	A	12: 108,652,996	D70E	probably damaging	Het
Fam35a	A	G	14: 34,267,803	I382T	probably benign	Het
Fbln2	A	G	6: 91,265,775	N819S	probably damaging	Het
Foxk2	A	G	11: 121,285,537	I170V	probably benign	Het
Gfm1	T	C	3: 67,435,610	V159A	probably damaging	Het
Gm10837	A	G	14: 122,490,765	T18A	unknown	Het
Gm12887	A	T	4: 121,622,030	V25E	probably damaging	Het
Hectd4	A	G	5: 121,297,180	H985R	possibly damaging	Het
Hsfy2	A	G	1: 56,636,632	Y249H	possibly damaging	Het
Hspg2	T	C	4: 137,545,567	V2639A	probably damaging	Het
Igf2r	A	G	17: 12,704,270		probably null	Het
Invs	T	A	4: 48,422,035	I889N	probably damaging	Het
Kcnq1	A	T	7: 143,183,120	M209L	probably benign	Het
Klra7	A	G	6: 130,229,994	I48T	possibly damaging	Het
Krt26	CTAGTA	CTA	11: 99,333,526		probably benign	Het
Lrif1	T	A	3: 106,732,811	V404D	probably damaging	Het
Lrriq1	T	A	10: 103,227,173		probably null	Het
Lypd6	T	A	2: 50,188,762	I90N	possibly damaging	Het
Mbp	A	G	18: 82,584,122	D174G	probably damaging	Het
Megf9	G	T	4: 70,534,785	P13Q	probably damaging	Het
Myo15b	A	T	11: 115,869,586	T1155S	probably benign	Het
Nlrp6	T	A	7: 140,923,093	C371S	probably damaging	Het
Nosip	T	A	7: 45,077,309		probably null	Het
Nox3	G	T	17: 3,669,878	P344H	probably damaging	Het
Olfr1360	C	A	13: 21,674,672	V91L	probably benign	Het
Olfr1475	A	G	19: 13,479,931	I89T	probably benign	Het
Olfr175-ps1	T	A	16: 58,824,077	I211F	probably damaging	Het
Olfr267	T	C	4: 58,785,384	I113V	probably benign	Het
Olfr959	A	G	9: 39,572,735	Y175H	possibly damaging	Het
Osbpl3	A	C	6: 50,370,143	S25A	probably damaging	Het
Otog	G	A	7: 46,246,283	C107Y	probably damaging	Het
Pax7	G	A	4: 139,784,491	R260C	probably damaging	Het
Pbrm1	A	T	14: 31,038,957	I224F	probably damaging	Het
Pcdh1	T	A	18: 38,192,225		probably null	Het
Pcnx	T	C	12: 81,980,935	L1585P	probably damaging	Het
Pde4c	C	T	8: 70,747,950	H362Y	probably damaging	Het
Pdlim2	C	T	14: 70,164,779	R296H	probably damaging	Het
Pgm2	A	T	4: 99,961,478	Q90L	probably damaging	Het
Phlpp1	A	G	1: 106,343,505	H814R	probably benign	Het
Pknox2	A	T	9: 36,954,831	M5K	possibly damaging	Het
Pole	G	A	5: 110,330,835		probably null	Het
Polr1b	A	G	2: 129,102,966	I61V	probably benign	Het
Prelp	T	C	1: 133,914,757	K217E	probably damaging	Het
Prkce	C	T	17: 86,475,546	Q202*	probably null	Het
Psmd2	T	G	16: 20,656,582	M370R	probably benign	Het
Rimklb	A	T	6: 122,464,009	H68Q	probably damaging	Het
Rnasel	A	G	1: 153,754,674	D312G	possibly damaging	Het
Rxrg	A	T	1: 167,598,752	M1L	probably benign	Het
Scrn1	A	G	6: 54,522,841	F220L	possibly damaging	Het
Scyl3	A	G	1: 163,950,675	S461G	probably benign	Het
Serpina1c	T	A	12: 103,895,023	T411S	probably benign	Het
Serpinb6d	C	T	13: 33,671,381	P346L	probably benign	Het
Slc9a3r2	C	T	17: 24,641,719	S150N	possibly damaging	Het
Spg21	G	T	9: 65,465,336	V17F	probably damaging	Het
Spink5	A	T	18: 43,999,891	M525L	probably benign	Het
Sun2	T	C	15: 79,737,563	T155A	probably benign	Het
Tchh	T	A	3: 93,446,780	F1176I	unknown	Het
Tex15	T	A	8: 33,576,654	D2037E	probably benign	Het
Tfdp2	T	C	9: 96,317,804	C392R	possibly damaging	Het
Tmem30c	T	C	16: 57,276,780	N139S	probably benign	Het
Tns2	C	T	15: 102,113,133		probably null	Het
Trim66	T	C	7: 109,475,839	E405G	probably damaging	Het
Trpc4	T	A	3: 54,279,994	F456I	probably benign	Het
Tspo2	T	C	17: 48,448,790	D108G	possibly damaging	Het
Tyk2	A	T	9: 21,121,554	C304*	probably null	Het
Vgll4	A	T	6: 114,862,795	S185T	probably benign	Het
Vmn2r94	A	C	17: 18,244,470	S519R	probably benign	Het
Vmn2r96	T	G	17: 18,597,921	S587A	probably benign	Het
Vps4b	C	A	1: 106,778,982	A287S	possibly damaging	Het
Yeats2	C	T	16: 20,229,564	P1332S	probably benign	Het
Zfp462	T	G	4: 55,010,010	S659A	possibly damaging	Het
Zfp507	C	T	7: 35,793,725	R631Q	probably damaging	Het
Zswim5	G	T	4: 116,877,699	E80D	unknown	Het

Other mutations in Nup210l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00780:Nup210l	APN	3	90190849	splice site	probably benign
IGL00813:Nup210l	APN	3	90132418	missense	probably benign	0.00
IGL01375:Nup210l	APN	3	90159893	missense	probably damaging	0.96
IGL01731:Nup210l	APN	3	90154566	missense	probably damaging	1.00
IGL01786:Nup210l	APN	3	90122776	nonsense	probably null
IGL01958:Nup210l	APN	3	90203924	missense	possibly damaging	0.74
IGL02094:Nup210l	APN	3	90180213	critical splice donor site	probably null
IGL02120:Nup210l	APN	3	90136862	missense	probably damaging	1.00
IGL02313:Nup210l	APN	3	90122792	missense	probably damaging	1.00
IGL02336:Nup210l	APN	3	90181552	critical splice donor site	probably null
IGL02348:Nup210l	APN	3	90104164	utr 5 prime	probably benign
IGL02372:Nup210l	APN	3	90201971	missense	possibly damaging	0.80
IGL02557:Nup210l	APN	3	90124230	missense	probably damaging	1.00
IGL02559:Nup210l	APN	3	90159953	missense	probably benign	0.02
IGL02738:Nup210l	APN	3	90136850	missense	possibly damaging	0.80
IGL03231:Nup210l	APN	3	90189545	missense	probably damaging	1.00
IGL03257:Nup210l	APN	3	90180148	critical splice acceptor site	probably null
IGL03388:Nup210l	APN	3	90170044	missense	probably damaging	1.00
IGL03134:Nup210l	UTSW	3	90190887	missense	possibly damaging	0.85
R0003:Nup210l	UTSW	3	90119911	missense	probably damaging	1.00
R0040:Nup210l	UTSW	3	90181905	missense	probably damaging	1.00
R0083:Nup210l	UTSW	3	90189575	missense	probably damaging	1.00
R0090:Nup210l	UTSW	3	90211779	missense	probably benign	0.00
R0108:Nup210l	UTSW	3	90189575	missense	probably damaging	1.00
R0142:Nup210l	UTSW	3	90172113	missense	probably damaging	1.00
R0306:Nup210l	UTSW	3	90207368	missense	probably benign	0.13
R0332:Nup210l	UTSW	3	90132309	splice site	probably benign
R0346:Nup210l	UTSW	3	90189438	missense	probably damaging	1.00
R0463:Nup210l	UTSW	3	90180211	missense	probably null	1.00
R0622:Nup210l	UTSW	3	90167740	missense	probably damaging	0.98
R0765:Nup210l	UTSW	3	90119877	missense	probably damaging	0.99
R0990:Nup210l	UTSW	3	90211925	missense	probably benign	0.00
R1014:Nup210l	UTSW	3	90170048	missense	possibly damaging	0.62
R1036:Nup210l	UTSW	3	90192940	splice site	probably benign
R1177:Nup210l	UTSW	3	90202003	missense	probably benign	0.11
R1183:Nup210l	UTSW	3	90159945	missense	probably benign	0.04
R1188:Nup210l	UTSW	3	90198179	missense	probably benign	0.16
R1457:Nup210l	UTSW	3	90190972	missense	possibly damaging	0.68
R1471:Nup210l	UTSW	3	90170562	missense	probably benign
R1627:Nup210l	UTSW	3	90144169	missense	probably benign	0.15
R1778:Nup210l	UTSW	3	90189486	missense	probably damaging	0.99
R1827:Nup210l	UTSW	3	90154557	missense	probably damaging	1.00
R1858:Nup210l	UTSW	3	90154499	missense	probably damaging	0.97
R1942:Nup210l	UTSW	3	90151237	missense	probably benign	0.01
R2015:Nup210l	UTSW	3	90185432	missense	probably damaging	1.00
R2113:Nup210l	UTSW	3	90190974	missense	possibly damaging	0.48
R2944:Nup210l	UTSW	3	90181545	missense	probably damaging	1.00
R3736:Nup210l	UTSW	3	90120013	missense	probably damaging	1.00
R3740:Nup210l	UTSW	3	90207394	missense	probably benign	0.08
R3741:Nup210l	UTSW	3	90207394	missense	probably benign	0.08
R3742:Nup210l	UTSW	3	90207394	missense	probably benign	0.08
R3771:Nup210l	UTSW	3	90119894	nonsense	probably null
R3773:Nup210l	UTSW	3	90119894	nonsense	probably null
R3879:Nup210l	UTSW	3	90185473	missense	probably damaging	1.00
R3882:Nup210l	UTSW	3	90124210	missense	probably benign	0.19
R3953:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R3954:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R3955:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R3956:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R4200:Nup210l	UTSW	3	90119911	missense	probably damaging	1.00
R4290:Nup210l	UTSW	3	90207326	missense	probably benign	0.00
R4328:Nup210l	UTSW	3	90175835	splice site	probably null
R4629:Nup210l	UTSW	3	90167875	missense	probably benign	0.21
R4629:Nup210l	UTSW	3	90190874	nonsense	probably null
R4897:Nup210l	UTSW	3	90193071	missense	probably damaging	1.00
R4906:Nup210l	UTSW	3	90170030	missense	probably benign	0.06
R4966:Nup210l	UTSW	3	90106901	missense	probably benign	0.00
R5004:Nup210l	UTSW	3	90180165	nonsense	probably null
R5237:Nup210l	UTSW	3	90180198	missense	probably benign	0.00
R5499:Nup210l	UTSW	3	90174370	missense	probably damaging	1.00
R5522:Nup210l	UTSW	3	90154665	missense	probably benign	0.10
R5627:Nup210l	UTSW	3	90144250	missense	probably damaging	0.97
R5678:Nup210l	UTSW	3	90190959	missense	probably damaging	0.99
R5726:Nup210l	UTSW	3	90129207	splice site	probably null
R5792:Nup210l	UTSW	3	90199857	missense	probably damaging	1.00
R6129:Nup210l	UTSW	3	90104176	missense	probably benign	0.00
R6272:Nup210l	UTSW	3	90170024	missense	possibly damaging	0.57
R6290:Nup210l	UTSW	3	90119909	nonsense	probably null
R6293:Nup210l	UTSW	3	90115064	missense	probably damaging	1.00
R6446:Nup210l	UTSW	3	90172068	missense	probably damaging	1.00
R6698:Nup210l	UTSW	3	90182508	missense	possibly damaging	0.57
R6855:Nup210l	UTSW	3	90136924	missense	probably benign	0.01
R6895:Nup210l	UTSW	3	90159924	missense	probably damaging	0.97
R6899:Nup210l	UTSW	3	90167897	missense	possibly damaging	0.77
R6978:Nup210l	UTSW	3	90154566	missense	possibly damaging	0.86
R6980:Nup210l	UTSW	3	90119927	missense	probably benign	0.04
R7038:Nup210l	UTSW	3	90159947	missense	probably damaging	1.00
R7273:Nup210l	UTSW	3	90118547	missense	probably benign	0.04
R7450:Nup210l	UTSW	3	90115188	critical splice donor site	probably null
R7514:Nup210l	UTSW	3	90210459	critical splice donor site	probably null
R7658:Nup210l	UTSW	3	90211993	missense	probably benign	0.43
R7735:Nup210l	UTSW	3	90185576	missense	probably damaging	1.00
R7772:Nup210l	UTSW	3	90159926	missense	probably damaging	1.00
R7800:Nup210l	UTSW	3	90134597	missense	probably damaging	1.00
R7840:Nup210l	UTSW	3	90122729	missense	probably benign	0.08
R7847:Nup210l	UTSW	3	90151123	missense	probably benign
R7848:Nup210l	UTSW	3	90203905	missense	probably benign	0.01
R8084:Nup210l	UTSW	3	90136058	missense	probably benign	0.15
R8121:Nup210l	UTSW	3	90115121	missense	probably damaging	1.00
R8421:Nup210l	UTSW	3	90203867	missense	probably damaging	1.00
R8458:Nup210l	UTSW	3	90185567	missense	probably null	1.00
R8701:Nup210l	UTSW	3	90122814	missense	probably benign	0.41
R8720:Nup210l	UTSW	3	90210374	missense	probably benign	0.00
R8770:Nup210l	UTSW	3	90118543	missense	probably damaging	1.00
R8896:Nup210l	UTSW	3	90118625	missense	probably damaging	1.00
R9033:Nup210l	UTSW	3	90198089	missense	probably benign
R9371:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9373:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9381:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9426:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9427:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9501:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9523:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9574:Nup210l	UTSW	3	90210386	missense	probably benign
R9612:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9654:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9660:Nup210l	UTSW	3	90198095	missense	probably benign	0.30
R9660:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9662:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9682:Nup210l	UTSW	3	90144162	missense	possibly damaging	0.79
R9729:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9750:Nup210l	UTSW	3	90210352	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- GAGGCCATGCTTATTCAAACC -3'
(R):5'- CTGTAGCTGAGAAGAGACTGCG -3'

Sequencing Primer
(F):5'- GGCCATGCTTATTCAAACCAACAG -3'
(R):5'- CTGCGTTAAGACACTGTAAGGGC -3'

Posted On

2014-06-23