Incidental Mutation 'R1843:Tchh'
ID 207397
Institutional Source Beutler Lab
Gene Symbol Tchh
Ensembl Gene ENSMUSG00000052415
Gene Name trichohyalin
Synonyms AHF, Thh
MMRRC Submission 039868-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.055) question?
Stock # R1843 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 93349637-93356384 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 93354087 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 1176 (F1176I)
Ref Sequence ENSEMBL: ENSMUSP00000069525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064257]
AlphaFold A0A0B4J1F9
Predicted Effect unknown
Transcript: ENSMUST00000064257
AA Change: F1176I
SMART Domains Protein: ENSMUSP00000069525
Gene: ENSMUSG00000052415
AA Change: F1176I

DomainStartEndE-ValueType
Pfam:S_100 4 46 3.5e-15 PFAM
Blast:EFh 53 81 4e-9 BLAST
low complexity region 110 123 N/A INTRINSIC
coiled coil region 137 370 N/A INTRINSIC
internal_repeat_2 374 384 2.35e-6 PROSPERO
internal_repeat_1 382 400 4.53e-15 PROSPERO
low complexity region 403 431 N/A INTRINSIC
internal_repeat_2 432 442 2.35e-6 PROSPERO
low complexity region 443 469 N/A INTRINSIC
low complexity region 480 494 N/A INTRINSIC
low complexity region 497 511 N/A INTRINSIC
coiled coil region 516 625 N/A INTRINSIC
internal_repeat_1 627 645 4.53e-15 PROSPERO
coiled coil region 661 700 N/A INTRINSIC
low complexity region 717 734 N/A INTRINSIC
coiled coil region 738 821 N/A INTRINSIC
low complexity region 827 844 N/A INTRINSIC
low complexity region 847 864 N/A INTRINSIC
low complexity region 867 905 N/A INTRINSIC
coiled coil region 927 1049 N/A INTRINSIC
coiled coil region 1073 1263 N/A INTRINSIC
coiled coil region 1295 1570 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195137
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik C T 8: 106,435,606 (GRCm39) T88M probably damaging Het
9430038I01Rik A G 7: 136,978,795 (GRCm39) probably benign Het
Adgra3 A C 5: 50,118,834 (GRCm39) S905A probably damaging Het
Adgrv1 A G 13: 81,692,652 (GRCm39) Y1618H probably damaging Het
Anapc15-ps T C 10: 95,509,176 (GRCm39) T26A probably benign Het
Ankrd13d T C 19: 4,321,623 (GRCm39) K360E probably damaging Het
Anks1b T A 10: 90,348,751 (GRCm39) probably null Het
Apob T C 12: 8,057,602 (GRCm39) F2028S possibly damaging Het
Arap3 G A 18: 38,108,636 (GRCm39) R1265W probably damaging Het
Arhgef37 A G 18: 61,651,121 (GRCm39) Y135H probably damaging Het
Armh3 A C 19: 45,963,691 (GRCm39) S42R probably benign Het
Atp1a1 T C 3: 101,489,333 (GRCm39) T760A probably benign Het
Cdc42bpb T A 12: 111,289,255 (GRCm39) M497L probably benign Het
Ces5a C T 8: 94,240,859 (GRCm39) V413M probably damaging Het
Chd5 A T 4: 152,470,263 (GRCm39) Y1903F probably damaging Het
Chd9 T A 8: 91,737,422 (GRCm39) N1500K probably benign Het
Chmp7 G T 14: 69,957,248 (GRCm39) D303E probably benign Het
Chrnb4 A T 9: 54,942,102 (GRCm39) Y391N possibly damaging Het
Crtc1 T C 8: 70,840,802 (GRCm39) T475A probably benign Het
Cyp2c69 A G 19: 39,865,972 (GRCm39) I207T probably benign Het
Dcp1a A G 14: 30,240,940 (GRCm39) E250G probably damaging Het
Ddx20 T C 3: 105,586,398 (GRCm39) Q649R probably benign Het
Defb12 T A 8: 19,162,754 (GRCm39) K59N probably damaging Het
Dpy19l3 A T 7: 35,429,185 (GRCm39) I85N probably damaging Het
Duox2 C T 2: 122,122,739 (GRCm39) probably null Het
Ebi3 T A 17: 56,263,679 (GRCm39) Y197N probably damaging Het
Emc1 G A 4: 139,102,823 (GRCm39) R994Q probably benign Het
Ercc6 G T 14: 32,268,777 (GRCm39) M530I probably damaging Het
Evl T A 12: 108,619,255 (GRCm39) D70E probably damaging Het
Fbln2 A G 6: 91,242,757 (GRCm39) N819S probably damaging Het
Foxk2 A G 11: 121,176,363 (GRCm39) I170V probably benign Het
Gfm1 T C 3: 67,342,943 (GRCm39) V159A probably damaging Het
Gm10837 A G 14: 122,728,177 (GRCm39) T18A unknown Het
Gm12887 A T 4: 121,479,227 (GRCm39) V25E probably damaging Het
Hectd4 A G 5: 121,435,243 (GRCm39) H985R possibly damaging Het
Hsfy2 A G 1: 56,675,791 (GRCm39) Y249H possibly damaging Het
Hspg2 T C 4: 137,272,878 (GRCm39) V2639A probably damaging Het
Igf2r A G 17: 12,923,157 (GRCm39) probably null Het
Invs T A 4: 48,422,035 (GRCm39) I889N probably damaging Het
Kcnq1 A T 7: 142,736,857 (GRCm39) M209L probably benign Het
Klra7 A G 6: 130,206,957 (GRCm39) I48T possibly damaging Het
Krt26 CTAGTA CTA 11: 99,224,352 (GRCm39) probably benign Het
Lrif1 T A 3: 106,640,127 (GRCm39) V404D probably damaging Het
Lrriq1 T A 10: 103,063,034 (GRCm39) probably null Het
Lypd6 T A 2: 50,078,774 (GRCm39) I90N possibly damaging Het
Mbp A G 18: 82,602,247 (GRCm39) D174G probably damaging Het
Megf9 G T 4: 70,453,022 (GRCm39) P13Q probably damaging Het
Myo15b A T 11: 115,760,412 (GRCm39) T1155S probably benign Het
Nherf2 C T 17: 24,860,693 (GRCm39) S150N possibly damaging Het
Nlrp6 T A 7: 140,503,006 (GRCm39) C371S probably damaging Het
Nosip T A 7: 44,726,733 (GRCm39) probably null Het
Nox3 G T 17: 3,720,153 (GRCm39) P344H probably damaging Het
Nup210l T C 3: 90,079,393 (GRCm39) V959A probably damaging Het
Or10d1 A G 9: 39,484,031 (GRCm39) Y175H possibly damaging Het
Or2b2b C A 13: 21,858,842 (GRCm39) V91L probably benign Het
Or2k2 T C 4: 58,785,384 (GRCm39) I113V probably benign Het
Or5b119 A G 19: 13,457,295 (GRCm39) I89T probably benign Het
Or5k8 T A 16: 58,644,440 (GRCm39) I211F probably damaging Het
Osbpl3 A C 6: 50,347,123 (GRCm39) S25A probably damaging Het
Otog G A 7: 45,895,707 (GRCm39) C107Y probably damaging Het
Pax7 G A 4: 139,511,802 (GRCm39) R260C probably damaging Het
Pbrm1 A T 14: 30,760,914 (GRCm39) I224F probably damaging Het
Pcdh1 T A 18: 38,325,278 (GRCm39) probably null Het
Pcnx1 T C 12: 82,027,709 (GRCm39) L1585P probably damaging Het
Pde4c C T 8: 71,200,599 (GRCm39) H362Y probably damaging Het
Pdlim2 C T 14: 70,402,228 (GRCm39) R296H probably damaging Het
Pgm1 A T 4: 99,818,675 (GRCm39) Q90L probably damaging Het
Phlpp1 A G 1: 106,271,235 (GRCm39) H814R probably benign Het
Pknox2 A T 9: 36,866,127 (GRCm39) M5K possibly damaging Het
Pole G A 5: 110,478,701 (GRCm39) probably null Het
Polr1b A G 2: 128,944,886 (GRCm39) I61V probably benign Het
Prelp T C 1: 133,842,495 (GRCm39) K217E probably damaging Het
Prkce C T 17: 86,782,974 (GRCm39) Q202* probably null Het
Psmd2 T G 16: 20,475,332 (GRCm39) M370R probably benign Het
Rimklb A T 6: 122,440,968 (GRCm39) H68Q probably damaging Het
Rnasel A G 1: 153,630,420 (GRCm39) D312G possibly damaging Het
Rxrg A T 1: 167,426,321 (GRCm39) M1L probably benign Het
Scrn1 A G 6: 54,499,826 (GRCm39) F220L possibly damaging Het
Scyl3 A G 1: 163,778,244 (GRCm39) S461G probably benign Het
Serpina1c T A 12: 103,861,282 (GRCm39) T411S probably benign Het
Serpinb6d C T 13: 33,855,364 (GRCm39) P346L probably benign Het
Shld2 A G 14: 33,989,760 (GRCm39) I382T probably benign Het
Spg21 G T 9: 65,372,618 (GRCm39) V17F probably damaging Het
Spink5 A T 18: 44,132,958 (GRCm39) M525L probably benign Het
Sun2 T C 15: 79,621,764 (GRCm39) T155A probably benign Het
Tex15 T A 8: 34,066,682 (GRCm39) D2037E probably benign Het
Tfdp2 T C 9: 96,199,857 (GRCm39) C392R possibly damaging Het
Tmem30c T C 16: 57,097,143 (GRCm39) N139S probably benign Het
Tns2 C T 15: 102,021,568 (GRCm39) probably null Het
Trim66 T C 7: 109,075,046 (GRCm39) E405G probably damaging Het
Trpc4 T A 3: 54,187,415 (GRCm39) F456I probably benign Het
Tspo2 T C 17: 48,755,818 (GRCm39) D108G possibly damaging Het
Tyk2 A T 9: 21,032,850 (GRCm39) C304* probably null Het
Vgll4 A T 6: 114,839,756 (GRCm39) S185T probably benign Het
Vmn2r94 A C 17: 18,464,732 (GRCm39) S519R probably benign Het
Vmn2r96 T G 17: 18,818,183 (GRCm39) S587A probably benign Het
Vps4b C A 1: 106,706,712 (GRCm39) A287S possibly damaging Het
Yeats2 C T 16: 20,048,314 (GRCm39) P1332S probably benign Het
Zfp462 T G 4: 55,010,010 (GRCm39) S659A possibly damaging Het
Zfp507 C T 7: 35,493,150 (GRCm39) R631Q probably damaging Het
Zfp764l1 A C 7: 126,990,660 (GRCm39) D442E probably benign Het
Zswim5 G T 4: 116,734,896 (GRCm39) E80D unknown Het
Other mutations in Tchh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Tchh APN 3 93,352,606 (GRCm39) missense unknown
IGL00338:Tchh APN 3 93,354,951 (GRCm39) missense unknown
IGL00541:Tchh APN 3 93,353,557 (GRCm39) missense unknown
IGL02510:Tchh APN 3 93,351,385 (GRCm39) missense unknown
IGL02622:Tchh APN 3 93,350,719 (GRCm39) missense probably damaging 1.00
IGL03164:Tchh APN 3 93,352,699 (GRCm39) missense unknown
IGL03331:Tchh APN 3 93,350,725 (GRCm39) missense probably damaging 1.00
PIT4453001:Tchh UTSW 3 93,353,187 (GRCm39) missense unknown
R0334:Tchh UTSW 3 93,352,923 (GRCm39) missense unknown
R0603:Tchh UTSW 3 93,351,088 (GRCm39) missense possibly damaging 0.91
R1186:Tchh UTSW 3 93,355,353 (GRCm39) missense unknown
R1241:Tchh UTSW 3 93,352,279 (GRCm39) missense unknown
R1610:Tchh UTSW 3 93,352,146 (GRCm39) missense unknown
R1768:Tchh UTSW 3 93,350,882 (GRCm39) missense possibly damaging 0.68
R1866:Tchh UTSW 3 93,355,067 (GRCm39) missense unknown
R1978:Tchh UTSW 3 93,354,106 (GRCm39) missense unknown
R2008:Tchh UTSW 3 93,353,281 (GRCm39) missense unknown
R2011:Tchh UTSW 3 93,354,268 (GRCm39) missense unknown
R2087:Tchh UTSW 3 93,351,225 (GRCm39) missense unknown
R2177:Tchh UTSW 3 93,351,439 (GRCm39) missense unknown
R2292:Tchh UTSW 3 93,349,689 (GRCm39) missense probably damaging 1.00
R2418:Tchh UTSW 3 93,352,936 (GRCm39) missense unknown
R2877:Tchh UTSW 3 93,351,535 (GRCm39) missense unknown
R2995:Tchh UTSW 3 93,355,057 (GRCm39) small deletion probably benign
R2997:Tchh UTSW 3 93,355,057 (GRCm39) small deletion probably benign
R3439:Tchh UTSW 3 93,354,700 (GRCm39) missense unknown
R3440:Tchh UTSW 3 93,352,414 (GRCm39) missense unknown
R3441:Tchh UTSW 3 93,352,414 (GRCm39) missense unknown
R4063:Tchh UTSW 3 93,354,298 (GRCm39) missense unknown
R4550:Tchh UTSW 3 93,352,617 (GRCm39) missense unknown
R4720:Tchh UTSW 3 93,355,189 (GRCm39) missense unknown
R4836:Tchh UTSW 3 93,354,895 (GRCm39) missense unknown
R4836:Tchh UTSW 3 93,352,455 (GRCm39) missense unknown
R4880:Tchh UTSW 3 93,351,130 (GRCm39) missense possibly damaging 0.85
R4895:Tchh UTSW 3 93,352,993 (GRCm39) missense unknown
R5188:Tchh UTSW 3 93,353,986 (GRCm39) missense unknown
R5404:Tchh UTSW 3 93,354,982 (GRCm39) missense unknown
R5435:Tchh UTSW 3 93,350,979 (GRCm39) missense possibly damaging 0.53
R5578:Tchh UTSW 3 93,351,618 (GRCm39) nonsense probably null
R5678:Tchh UTSW 3 93,352,933 (GRCm39) missense unknown
R5697:Tchh UTSW 3 93,352,350 (GRCm39) nonsense probably null
R5768:Tchh UTSW 3 93,353,488 (GRCm39) missense unknown
R5809:Tchh UTSW 3 93,352,880 (GRCm39) missense unknown
R5934:Tchh UTSW 3 93,351,419 (GRCm39) missense unknown
R5945:Tchh UTSW 3 93,352,644 (GRCm39) missense unknown
R6313:Tchh UTSW 3 93,355,158 (GRCm39) missense unknown
R6329:Tchh UTSW 3 93,353,752 (GRCm39) missense unknown
R6397:Tchh UTSW 3 93,353,173 (GRCm39) missense unknown
R6818:Tchh UTSW 3 93,350,718 (GRCm39) missense probably damaging 1.00
R6997:Tchh UTSW 3 93,354,015 (GRCm39) small deletion probably benign
R7174:Tchh UTSW 3 93,353,478 (GRCm39) missense unknown
R7268:Tchh UTSW 3 93,354,015 (GRCm39) small deletion probably benign
R7270:Tchh UTSW 3 93,351,837 (GRCm39) missense unknown
R7449:Tchh UTSW 3 93,354,015 (GRCm39) small deletion probably benign
R7745:Tchh UTSW 3 93,352,084 (GRCm39) missense unknown
R8201:Tchh UTSW 3 93,350,781 (GRCm39) missense probably damaging 0.98
R8375:Tchh UTSW 3 93,354,015 (GRCm39) small deletion probably benign
R8438:Tchh UTSW 3 93,354,015 (GRCm39) small deletion probably benign
R8676:Tchh UTSW 3 93,354,015 (GRCm39) small deletion probably benign
R8801:Tchh UTSW 3 93,354,015 (GRCm39) small deletion probably benign
R8893:Tchh UTSW 3 93,354,957 (GRCm39) nonsense probably null
R9104:Tchh UTSW 3 93,354,610 (GRCm39) missense unknown
R9318:Tchh UTSW 3 93,354,051 (GRCm39) missense unknown
R9328:Tchh UTSW 3 93,351,570 (GRCm39) missense unknown
R9386:Tchh UTSW 3 93,354,346 (GRCm39) missense unknown
R9499:Tchh UTSW 3 93,354,015 (GRCm39) small deletion probably benign
R9553:Tchh UTSW 3 93,355,125 (GRCm39) nonsense probably null
R9644:Tchh UTSW 3 93,354,666 (GRCm39) missense unknown
Z1088:Tchh UTSW 3 93,352,989 (GRCm39) nonsense probably null
Z1176:Tchh UTSW 3 93,354,166 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GCCAGGAACTTGACAGAAAATTC -3'
(R):5'- CACGGAATTTTCTGTCACGTTC -3'

Sequencing Primer
(F):5'- AACTTGACAGAAAATTCCGTGAG -3'
(R):5'- CAGTCCCTGGCGGAGTTCTTG -3'
Posted On 2014-06-23