Incidental Mutation 'R1843:Atp1a1'
ID 207399
Institutional Source Beutler Lab
Gene Symbol Atp1a1
Ensembl Gene ENSMUSG00000033161
Gene Name ATPase, Na+/K+ transporting, alpha 1 polypeptide
Synonyms Atpa-1
MMRRC Submission 039868-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1843 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 101483535-101512000 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 101489333 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 760 (T760A)
Ref Sequence ENSEMBL: ENSMUSP00000039657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036493]
AlphaFold Q8VDN2
Predicted Effect probably benign
Transcript: ENSMUST00000036493
AA Change: T760A

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000039657
Gene: ENSMUSG00000033161
AA Change: T760A

DomainStartEndE-ValueType
low complexity region 21 28 N/A INTRINSIC
Cation_ATPase_N 42 116 5e-20 SMART
Pfam:E1-E2_ATPase 134 365 1.6e-59 PFAM
Pfam:Hydrolase 370 729 2.7e-19 PFAM
Pfam:HAD 373 726 1.3e-18 PFAM
Pfam:Cation_ATPase 426 521 2.2e-25 PFAM
Pfam:Cation_ATPase_C 799 1008 1.2e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130649
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136340
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197360
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 1 subunit. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene have a lethal phenotype. Heterozygotes display increased anxiety and decreased exploratory behavior in a new environment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik C T 8: 106,435,606 (GRCm39) T88M probably damaging Het
9430038I01Rik A G 7: 136,978,795 (GRCm39) probably benign Het
Adgra3 A C 5: 50,118,834 (GRCm39) S905A probably damaging Het
Adgrv1 A G 13: 81,692,652 (GRCm39) Y1618H probably damaging Het
Anapc15-ps T C 10: 95,509,176 (GRCm39) T26A probably benign Het
Ankrd13d T C 19: 4,321,623 (GRCm39) K360E probably damaging Het
Anks1b T A 10: 90,348,751 (GRCm39) probably null Het
Apob T C 12: 8,057,602 (GRCm39) F2028S possibly damaging Het
Arap3 G A 18: 38,108,636 (GRCm39) R1265W probably damaging Het
Arhgef37 A G 18: 61,651,121 (GRCm39) Y135H probably damaging Het
Armh3 A C 19: 45,963,691 (GRCm39) S42R probably benign Het
Cdc42bpb T A 12: 111,289,255 (GRCm39) M497L probably benign Het
Ces5a C T 8: 94,240,859 (GRCm39) V413M probably damaging Het
Chd5 A T 4: 152,470,263 (GRCm39) Y1903F probably damaging Het
Chd9 T A 8: 91,737,422 (GRCm39) N1500K probably benign Het
Chmp7 G T 14: 69,957,248 (GRCm39) D303E probably benign Het
Chrnb4 A T 9: 54,942,102 (GRCm39) Y391N possibly damaging Het
Crtc1 T C 8: 70,840,802 (GRCm39) T475A probably benign Het
Cyp2c69 A G 19: 39,865,972 (GRCm39) I207T probably benign Het
Dcp1a A G 14: 30,240,940 (GRCm39) E250G probably damaging Het
Ddx20 T C 3: 105,586,398 (GRCm39) Q649R probably benign Het
Defb12 T A 8: 19,162,754 (GRCm39) K59N probably damaging Het
Dpy19l3 A T 7: 35,429,185 (GRCm39) I85N probably damaging Het
Duox2 C T 2: 122,122,739 (GRCm39) probably null Het
Ebi3 T A 17: 56,263,679 (GRCm39) Y197N probably damaging Het
Emc1 G A 4: 139,102,823 (GRCm39) R994Q probably benign Het
Ercc6 G T 14: 32,268,777 (GRCm39) M530I probably damaging Het
Evl T A 12: 108,619,255 (GRCm39) D70E probably damaging Het
Fbln2 A G 6: 91,242,757 (GRCm39) N819S probably damaging Het
Foxk2 A G 11: 121,176,363 (GRCm39) I170V probably benign Het
Gfm1 T C 3: 67,342,943 (GRCm39) V159A probably damaging Het
Gm10837 A G 14: 122,728,177 (GRCm39) T18A unknown Het
Gm12887 A T 4: 121,479,227 (GRCm39) V25E probably damaging Het
Hectd4 A G 5: 121,435,243 (GRCm39) H985R possibly damaging Het
Hsfy2 A G 1: 56,675,791 (GRCm39) Y249H possibly damaging Het
Hspg2 T C 4: 137,272,878 (GRCm39) V2639A probably damaging Het
Igf2r A G 17: 12,923,157 (GRCm39) probably null Het
Invs T A 4: 48,422,035 (GRCm39) I889N probably damaging Het
Kcnq1 A T 7: 142,736,857 (GRCm39) M209L probably benign Het
Klra7 A G 6: 130,206,957 (GRCm39) I48T possibly damaging Het
Krt26 CTAGTA CTA 11: 99,224,352 (GRCm39) probably benign Het
Lrif1 T A 3: 106,640,127 (GRCm39) V404D probably damaging Het
Lrriq1 T A 10: 103,063,034 (GRCm39) probably null Het
Lypd6 T A 2: 50,078,774 (GRCm39) I90N possibly damaging Het
Mbp A G 18: 82,602,247 (GRCm39) D174G probably damaging Het
Megf9 G T 4: 70,453,022 (GRCm39) P13Q probably damaging Het
Myo15b A T 11: 115,760,412 (GRCm39) T1155S probably benign Het
Nherf2 C T 17: 24,860,693 (GRCm39) S150N possibly damaging Het
Nlrp6 T A 7: 140,503,006 (GRCm39) C371S probably damaging Het
Nosip T A 7: 44,726,733 (GRCm39) probably null Het
Nox3 G T 17: 3,720,153 (GRCm39) P344H probably damaging Het
Nup210l T C 3: 90,079,393 (GRCm39) V959A probably damaging Het
Or10d1 A G 9: 39,484,031 (GRCm39) Y175H possibly damaging Het
Or2b2b C A 13: 21,858,842 (GRCm39) V91L probably benign Het
Or2k2 T C 4: 58,785,384 (GRCm39) I113V probably benign Het
Or5b119 A G 19: 13,457,295 (GRCm39) I89T probably benign Het
Or5k8 T A 16: 58,644,440 (GRCm39) I211F probably damaging Het
Osbpl3 A C 6: 50,347,123 (GRCm39) S25A probably damaging Het
Otog G A 7: 45,895,707 (GRCm39) C107Y probably damaging Het
Pax7 G A 4: 139,511,802 (GRCm39) R260C probably damaging Het
Pbrm1 A T 14: 30,760,914 (GRCm39) I224F probably damaging Het
Pcdh1 T A 18: 38,325,278 (GRCm39) probably null Het
Pcnx1 T C 12: 82,027,709 (GRCm39) L1585P probably damaging Het
Pde4c C T 8: 71,200,599 (GRCm39) H362Y probably damaging Het
Pdlim2 C T 14: 70,402,228 (GRCm39) R296H probably damaging Het
Pgm1 A T 4: 99,818,675 (GRCm39) Q90L probably damaging Het
Phlpp1 A G 1: 106,271,235 (GRCm39) H814R probably benign Het
Pknox2 A T 9: 36,866,127 (GRCm39) M5K possibly damaging Het
Pole G A 5: 110,478,701 (GRCm39) probably null Het
Polr1b A G 2: 128,944,886 (GRCm39) I61V probably benign Het
Prelp T C 1: 133,842,495 (GRCm39) K217E probably damaging Het
Prkce C T 17: 86,782,974 (GRCm39) Q202* probably null Het
Psmd2 T G 16: 20,475,332 (GRCm39) M370R probably benign Het
Rimklb A T 6: 122,440,968 (GRCm39) H68Q probably damaging Het
Rnasel A G 1: 153,630,420 (GRCm39) D312G possibly damaging Het
Rxrg A T 1: 167,426,321 (GRCm39) M1L probably benign Het
Scrn1 A G 6: 54,499,826 (GRCm39) F220L possibly damaging Het
Scyl3 A G 1: 163,778,244 (GRCm39) S461G probably benign Het
Serpina1c T A 12: 103,861,282 (GRCm39) T411S probably benign Het
Serpinb6d C T 13: 33,855,364 (GRCm39) P346L probably benign Het
Shld2 A G 14: 33,989,760 (GRCm39) I382T probably benign Het
Spg21 G T 9: 65,372,618 (GRCm39) V17F probably damaging Het
Spink5 A T 18: 44,132,958 (GRCm39) M525L probably benign Het
Sun2 T C 15: 79,621,764 (GRCm39) T155A probably benign Het
Tchh T A 3: 93,354,087 (GRCm39) F1176I unknown Het
Tex15 T A 8: 34,066,682 (GRCm39) D2037E probably benign Het
Tfdp2 T C 9: 96,199,857 (GRCm39) C392R possibly damaging Het
Tmem30c T C 16: 57,097,143 (GRCm39) N139S probably benign Het
Tns2 C T 15: 102,021,568 (GRCm39) probably null Het
Trim66 T C 7: 109,075,046 (GRCm39) E405G probably damaging Het
Trpc4 T A 3: 54,187,415 (GRCm39) F456I probably benign Het
Tspo2 T C 17: 48,755,818 (GRCm39) D108G possibly damaging Het
Tyk2 A T 9: 21,032,850 (GRCm39) C304* probably null Het
Vgll4 A T 6: 114,839,756 (GRCm39) S185T probably benign Het
Vmn2r94 A C 17: 18,464,732 (GRCm39) S519R probably benign Het
Vmn2r96 T G 17: 18,818,183 (GRCm39) S587A probably benign Het
Vps4b C A 1: 106,706,712 (GRCm39) A287S possibly damaging Het
Yeats2 C T 16: 20,048,314 (GRCm39) P1332S probably benign Het
Zfp462 T G 4: 55,010,010 (GRCm39) S659A possibly damaging Het
Zfp507 C T 7: 35,493,150 (GRCm39) R631Q probably damaging Het
Zfp764l1 A C 7: 126,990,660 (GRCm39) D442E probably benign Het
Zswim5 G T 4: 116,734,896 (GRCm39) E80D unknown Het
Other mutations in Atp1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01396:Atp1a1 APN 3 101,498,769 (GRCm39) missense probably damaging 1.00
IGL01700:Atp1a1 APN 3 101,501,574 (GRCm39) missense possibly damaging 0.95
IGL01836:Atp1a1 APN 3 101,498,730 (GRCm39) missense probably damaging 1.00
IGL01863:Atp1a1 APN 3 101,499,205 (GRCm39) nonsense probably null
IGL02021:Atp1a1 APN 3 101,501,524 (GRCm39) missense probably benign 0.02
IGL02078:Atp1a1 APN 3 101,499,179 (GRCm39) missense probably damaging 1.00
IGL02873:Atp1a1 APN 3 101,483,894 (GRCm39) missense probably benign 0.16
IGL02934:Atp1a1 APN 3 101,484,308 (GRCm39) nonsense probably null
IGL03068:Atp1a1 APN 3 101,491,175 (GRCm39) missense probably benign 0.26
PIT4453001:Atp1a1 UTSW 3 101,488,495 (GRCm39) missense probably benign 0.01
R0009:Atp1a1 UTSW 3 101,487,151 (GRCm39) missense possibly damaging 0.67
R0506:Atp1a1 UTSW 3 101,497,128 (GRCm39) missense probably damaging 0.96
R0724:Atp1a1 UTSW 3 101,499,755 (GRCm39) missense possibly damaging 0.50
R0826:Atp1a1 UTSW 3 101,492,169 (GRCm39) missense probably damaging 0.99
R1457:Atp1a1 UTSW 3 101,497,782 (GRCm39) missense probably damaging 1.00
R1732:Atp1a1 UTSW 3 101,492,115 (GRCm39) missense probably damaging 1.00
R2172:Atp1a1 UTSW 3 101,497,864 (GRCm39) missense probably benign
R3770:Atp1a1 UTSW 3 101,488,510 (GRCm39) missense probably benign 0.17
R3905:Atp1a1 UTSW 3 101,497,928 (GRCm39) missense probably benign 0.00
R4602:Atp1a1 UTSW 3 101,494,259 (GRCm39) missense probably benign 0.00
R4611:Atp1a1 UTSW 3 101,494,259 (GRCm39) missense probably benign 0.00
R4715:Atp1a1 UTSW 3 101,499,122 (GRCm39) missense possibly damaging 0.90
R4777:Atp1a1 UTSW 3 101,502,312 (GRCm39) critical splice donor site probably null
R4795:Atp1a1 UTSW 3 101,491,091 (GRCm39) missense probably benign 0.15
R5030:Atp1a1 UTSW 3 101,487,133 (GRCm39) missense probably benign 0.22
R5066:Atp1a1 UTSW 3 101,489,420 (GRCm39) missense probably damaging 0.98
R5165:Atp1a1 UTSW 3 101,489,105 (GRCm39) missense probably benign 0.01
R5297:Atp1a1 UTSW 3 101,498,443 (GRCm39) missense possibly damaging 0.82
R5307:Atp1a1 UTSW 3 101,497,280 (GRCm39) missense probably damaging 1.00
R5379:Atp1a1 UTSW 3 101,489,411 (GRCm39) missense probably benign 0.01
R5495:Atp1a1 UTSW 3 101,498,741 (GRCm39) missense probably benign 0.01
R5946:Atp1a1 UTSW 3 101,497,090 (GRCm39) missense probably benign 0.12
R6125:Atp1a1 UTSW 3 101,498,023 (GRCm39) missense probably damaging 1.00
R6789:Atp1a1 UTSW 3 101,493,614 (GRCm39) missense possibly damaging 0.71
R7339:Atp1a1 UTSW 3 101,497,188 (GRCm39) missense probably benign 0.44
R7552:Atp1a1 UTSW 3 101,489,437 (GRCm39) nonsense probably null
R7825:Atp1a1 UTSW 3 101,493,485 (GRCm39) missense probably benign 0.00
R8098:Atp1a1 UTSW 3 101,489,365 (GRCm39) missense probably damaging 0.97
R8175:Atp1a1 UTSW 3 101,492,170 (GRCm39) missense possibly damaging 0.79
R8281:Atp1a1 UTSW 3 101,486,940 (GRCm39) missense probably benign 0.12
R8403:Atp1a1 UTSW 3 101,494,220 (GRCm39) missense probably damaging 1.00
R8435:Atp1a1 UTSW 3 101,490,078 (GRCm39) missense probably benign
R8461:Atp1a1 UTSW 3 101,496,405 (GRCm39) missense probably benign 0.01
R8772:Atp1a1 UTSW 3 101,487,124 (GRCm39) missense probably benign
R8782:Atp1a1 UTSW 3 101,501,533 (GRCm39) missense possibly damaging 0.63
R8919:Atp1a1 UTSW 3 101,498,547 (GRCm39) missense probably damaging 1.00
R9066:Atp1a1 UTSW 3 101,489,338 (GRCm39) missense probably damaging 1.00
R9227:Atp1a1 UTSW 3 101,499,750 (GRCm39) missense probably damaging 1.00
R9712:Atp1a1 UTSW 3 101,498,757 (GRCm39) missense probably benign 0.06
X0019:Atp1a1 UTSW 3 101,501,529 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGCAGAGGATGGTCACAGTC -3'
(R):5'- ATCCCTGCAAAGATTTGGGC -3'

Sequencing Primer
(F):5'- TATCAAGAAGGGGGTGATTTCC -3'
(R):5'- CAAAGATTTGGGCTTTATTAACCCCC -3'
Posted On 2014-06-23