Incidental Mutation 'R1843:Invs'
ID 207402
Institutional Source Beutler Lab
Gene Symbol Invs
Ensembl Gene ENSMUSG00000028344
Gene Name inversin
Synonyms
MMRRC Submission 039868-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.670) question?
Stock # R1843 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 48279760-48431954 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 48422035 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 889 (I889N)
Ref Sequence ENSEMBL: ENSMUSP00000030029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030029] [ENSMUST00000143433]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000030029
AA Change: I889N

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000030029
Gene: ENSMUSG00000028344
AA Change: I889N

DomainStartEndE-ValueType
ANK 47 76 2.66e-5 SMART
ANK 80 110 1.8e-2 SMART
ANK 113 144 1.63e0 SMART
ANK 148 177 6.46e-4 SMART
ANK 181 215 3.44e1 SMART
ANK 220 250 1.11e-2 SMART
ANK 254 285 2.07e-2 SMART
ANK 288 317 3.18e-3 SMART
ANK 321 350 3.91e-3 SMART
ANK 356 385 2.28e-4 SMART
ANK 389 418 8.39e-3 SMART
ANK 422 451 3.76e-5 SMART
ANK 455 484 2.45e-4 SMART
ANK 488 517 1.31e-4 SMART
ANK 523 553 6.71e-2 SMART
IQ 554 576 5.75e-2 SMART
low complexity region 589 607 N/A INTRINSIC
IQ 913 935 2.46e-1 SMART
low complexity region 973 989 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143433
SMART Domains Protein: ENSMUSP00000138580
Gene: ENSMUSG00000028344

DomainStartEndE-ValueType
ANK 47 76 2.66e-5 SMART
ANK 80 110 1.8e-2 SMART
ANK 113 144 1.63e0 SMART
ANK 164 194 1.11e-2 SMART
ANK 198 229 2.07e-2 SMART
ANK 232 261 3.18e-3 SMART
ANK 265 294 3.91e-3 SMART
ANK 300 329 2.28e-4 SMART
ANK 333 362 8.39e-3 SMART
ANK 366 395 3.76e-5 SMART
ANK 399 428 2.45e-4 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple ankyrin domains and two IQ calmodulin-binding domains. The encoded protein may function in renal tubular development and function, and in left-right axis determination. This protein interacts with nephrocystin and infers a connection between primary cilia function and left-right axis determination. A similar protein in mice interacts with calmodulin. Mutations in this gene have been associated with nephronophthisis type 2. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Transgenic mice homozygous for an insertional mutation exhibit complete inversion of the L-R body axis, reversal of embryo turning, complex cardiac anomalies, an abnormally slow turbulent leftward nodal flow, and renal cyst formation. Most succumb to renal failure within 1 week of life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik C T 8: 106,435,606 (GRCm39) T88M probably damaging Het
9430038I01Rik A G 7: 136,978,795 (GRCm39) probably benign Het
Adgra3 A C 5: 50,118,834 (GRCm39) S905A probably damaging Het
Adgrv1 A G 13: 81,692,652 (GRCm39) Y1618H probably damaging Het
Anapc15-ps T C 10: 95,509,176 (GRCm39) T26A probably benign Het
Ankrd13d T C 19: 4,321,623 (GRCm39) K360E probably damaging Het
Anks1b T A 10: 90,348,751 (GRCm39) probably null Het
Apob T C 12: 8,057,602 (GRCm39) F2028S possibly damaging Het
Arap3 G A 18: 38,108,636 (GRCm39) R1265W probably damaging Het
Arhgef37 A G 18: 61,651,121 (GRCm39) Y135H probably damaging Het
Armh3 A C 19: 45,963,691 (GRCm39) S42R probably benign Het
Atp1a1 T C 3: 101,489,333 (GRCm39) T760A probably benign Het
Cdc42bpb T A 12: 111,289,255 (GRCm39) M497L probably benign Het
Ces5a C T 8: 94,240,859 (GRCm39) V413M probably damaging Het
Chd5 A T 4: 152,470,263 (GRCm39) Y1903F probably damaging Het
Chd9 T A 8: 91,737,422 (GRCm39) N1500K probably benign Het
Chmp7 G T 14: 69,957,248 (GRCm39) D303E probably benign Het
Chrnb4 A T 9: 54,942,102 (GRCm39) Y391N possibly damaging Het
Crtc1 T C 8: 70,840,802 (GRCm39) T475A probably benign Het
Cyp2c69 A G 19: 39,865,972 (GRCm39) I207T probably benign Het
Dcp1a A G 14: 30,240,940 (GRCm39) E250G probably damaging Het
Ddx20 T C 3: 105,586,398 (GRCm39) Q649R probably benign Het
Defb12 T A 8: 19,162,754 (GRCm39) K59N probably damaging Het
Dpy19l3 A T 7: 35,429,185 (GRCm39) I85N probably damaging Het
Duox2 C T 2: 122,122,739 (GRCm39) probably null Het
Ebi3 T A 17: 56,263,679 (GRCm39) Y197N probably damaging Het
Emc1 G A 4: 139,102,823 (GRCm39) R994Q probably benign Het
Ercc6 G T 14: 32,268,777 (GRCm39) M530I probably damaging Het
Evl T A 12: 108,619,255 (GRCm39) D70E probably damaging Het
Fbln2 A G 6: 91,242,757 (GRCm39) N819S probably damaging Het
Foxk2 A G 11: 121,176,363 (GRCm39) I170V probably benign Het
Gfm1 T C 3: 67,342,943 (GRCm39) V159A probably damaging Het
Gm10837 A G 14: 122,728,177 (GRCm39) T18A unknown Het
Gm12887 A T 4: 121,479,227 (GRCm39) V25E probably damaging Het
Hectd4 A G 5: 121,435,243 (GRCm39) H985R possibly damaging Het
Hsfy2 A G 1: 56,675,791 (GRCm39) Y249H possibly damaging Het
Hspg2 T C 4: 137,272,878 (GRCm39) V2639A probably damaging Het
Igf2r A G 17: 12,923,157 (GRCm39) probably null Het
Kcnq1 A T 7: 142,736,857 (GRCm39) M209L probably benign Het
Klra7 A G 6: 130,206,957 (GRCm39) I48T possibly damaging Het
Krt26 CTAGTA CTA 11: 99,224,352 (GRCm39) probably benign Het
Lrif1 T A 3: 106,640,127 (GRCm39) V404D probably damaging Het
Lrriq1 T A 10: 103,063,034 (GRCm39) probably null Het
Lypd6 T A 2: 50,078,774 (GRCm39) I90N possibly damaging Het
Mbp A G 18: 82,602,247 (GRCm39) D174G probably damaging Het
Megf9 G T 4: 70,453,022 (GRCm39) P13Q probably damaging Het
Myo15b A T 11: 115,760,412 (GRCm39) T1155S probably benign Het
Nherf2 C T 17: 24,860,693 (GRCm39) S150N possibly damaging Het
Nlrp6 T A 7: 140,503,006 (GRCm39) C371S probably damaging Het
Nosip T A 7: 44,726,733 (GRCm39) probably null Het
Nox3 G T 17: 3,720,153 (GRCm39) P344H probably damaging Het
Nup210l T C 3: 90,079,393 (GRCm39) V959A probably damaging Het
Or10d1 A G 9: 39,484,031 (GRCm39) Y175H possibly damaging Het
Or2b2b C A 13: 21,858,842 (GRCm39) V91L probably benign Het
Or2k2 T C 4: 58,785,384 (GRCm39) I113V probably benign Het
Or5b119 A G 19: 13,457,295 (GRCm39) I89T probably benign Het
Or5k8 T A 16: 58,644,440 (GRCm39) I211F probably damaging Het
Osbpl3 A C 6: 50,347,123 (GRCm39) S25A probably damaging Het
Otog G A 7: 45,895,707 (GRCm39) C107Y probably damaging Het
Pax7 G A 4: 139,511,802 (GRCm39) R260C probably damaging Het
Pbrm1 A T 14: 30,760,914 (GRCm39) I224F probably damaging Het
Pcdh1 T A 18: 38,325,278 (GRCm39) probably null Het
Pcnx1 T C 12: 82,027,709 (GRCm39) L1585P probably damaging Het
Pde4c C T 8: 71,200,599 (GRCm39) H362Y probably damaging Het
Pdlim2 C T 14: 70,402,228 (GRCm39) R296H probably damaging Het
Pgm1 A T 4: 99,818,675 (GRCm39) Q90L probably damaging Het
Phlpp1 A G 1: 106,271,235 (GRCm39) H814R probably benign Het
Pknox2 A T 9: 36,866,127 (GRCm39) M5K possibly damaging Het
Pole G A 5: 110,478,701 (GRCm39) probably null Het
Polr1b A G 2: 128,944,886 (GRCm39) I61V probably benign Het
Prelp T C 1: 133,842,495 (GRCm39) K217E probably damaging Het
Prkce C T 17: 86,782,974 (GRCm39) Q202* probably null Het
Psmd2 T G 16: 20,475,332 (GRCm39) M370R probably benign Het
Rimklb A T 6: 122,440,968 (GRCm39) H68Q probably damaging Het
Rnasel A G 1: 153,630,420 (GRCm39) D312G possibly damaging Het
Rxrg A T 1: 167,426,321 (GRCm39) M1L probably benign Het
Scrn1 A G 6: 54,499,826 (GRCm39) F220L possibly damaging Het
Scyl3 A G 1: 163,778,244 (GRCm39) S461G probably benign Het
Serpina1c T A 12: 103,861,282 (GRCm39) T411S probably benign Het
Serpinb6d C T 13: 33,855,364 (GRCm39) P346L probably benign Het
Shld2 A G 14: 33,989,760 (GRCm39) I382T probably benign Het
Spg21 G T 9: 65,372,618 (GRCm39) V17F probably damaging Het
Spink5 A T 18: 44,132,958 (GRCm39) M525L probably benign Het
Sun2 T C 15: 79,621,764 (GRCm39) T155A probably benign Het
Tchh T A 3: 93,354,087 (GRCm39) F1176I unknown Het
Tex15 T A 8: 34,066,682 (GRCm39) D2037E probably benign Het
Tfdp2 T C 9: 96,199,857 (GRCm39) C392R possibly damaging Het
Tmem30c T C 16: 57,097,143 (GRCm39) N139S probably benign Het
Tns2 C T 15: 102,021,568 (GRCm39) probably null Het
Trim66 T C 7: 109,075,046 (GRCm39) E405G probably damaging Het
Trpc4 T A 3: 54,187,415 (GRCm39) F456I probably benign Het
Tspo2 T C 17: 48,755,818 (GRCm39) D108G possibly damaging Het
Tyk2 A T 9: 21,032,850 (GRCm39) C304* probably null Het
Vgll4 A T 6: 114,839,756 (GRCm39) S185T probably benign Het
Vmn2r94 A C 17: 18,464,732 (GRCm39) S519R probably benign Het
Vmn2r96 T G 17: 18,818,183 (GRCm39) S587A probably benign Het
Vps4b C A 1: 106,706,712 (GRCm39) A287S possibly damaging Het
Yeats2 C T 16: 20,048,314 (GRCm39) P1332S probably benign Het
Zfp462 T G 4: 55,010,010 (GRCm39) S659A possibly damaging Het
Zfp507 C T 7: 35,493,150 (GRCm39) R631Q probably damaging Het
Zfp764l1 A C 7: 126,990,660 (GRCm39) D442E probably benign Het
Zswim5 G T 4: 116,734,896 (GRCm39) E80D unknown Het
Other mutations in Invs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Invs APN 4 48,402,909 (GRCm39) missense probably damaging 0.98
IGL00487:Invs APN 4 48,407,689 (GRCm39) nonsense probably null
IGL01487:Invs APN 4 48,398,136 (GRCm39) missense probably benign 0.26
IGL01696:Invs APN 4 48,425,997 (GRCm39) missense probably damaging 1.00
IGL02238:Invs APN 4 48,390,029 (GRCm39) missense probably damaging 1.00
IGL03286:Invs APN 4 48,382,261 (GRCm39) missense probably benign 0.26
R0645:Invs UTSW 4 48,407,653 (GRCm39) missense probably benign 0.00
R0661:Invs UTSW 4 48,421,861 (GRCm39) missense probably benign
R0698:Invs UTSW 4 48,396,364 (GRCm39) missense probably benign 0.04
R0763:Invs UTSW 4 48,392,628 (GRCm39) missense possibly damaging 0.82
R1183:Invs UTSW 4 48,421,725 (GRCm39) missense possibly damaging 0.68
R1381:Invs UTSW 4 48,421,942 (GRCm39) nonsense probably null
R1511:Invs UTSW 4 48,382,148 (GRCm39) missense possibly damaging 0.82
R1903:Invs UTSW 4 48,402,824 (GRCm39) splice site probably null
R1928:Invs UTSW 4 48,390,095 (GRCm39) missense probably damaging 1.00
R1990:Invs UTSW 4 48,392,599 (GRCm39) missense possibly damaging 0.88
R2063:Invs UTSW 4 48,396,287 (GRCm39) missense probably damaging 1.00
R2064:Invs UTSW 4 48,396,287 (GRCm39) missense probably damaging 1.00
R2065:Invs UTSW 4 48,396,287 (GRCm39) missense probably damaging 1.00
R2066:Invs UTSW 4 48,396,287 (GRCm39) missense probably damaging 1.00
R4744:Invs UTSW 4 48,397,609 (GRCm39) missense probably damaging 1.00
R4997:Invs UTSW 4 48,396,332 (GRCm39) missense probably damaging 0.98
R5011:Invs UTSW 4 48,421,807 (GRCm39) missense probably damaging 1.00
R5013:Invs UTSW 4 48,421,807 (GRCm39) missense probably damaging 1.00
R5083:Invs UTSW 4 48,396,307 (GRCm39) missense possibly damaging 0.90
R5184:Invs UTSW 4 48,283,242 (GRCm39) utr 5 prime probably benign
R5258:Invs UTSW 4 48,396,374 (GRCm39) missense possibly damaging 0.82
R5375:Invs UTSW 4 48,385,262 (GRCm39) missense probably benign 0.12
R5509:Invs UTSW 4 48,396,337 (GRCm39) missense probably damaging 1.00
R5560:Invs UTSW 4 48,416,084 (GRCm39) missense probably benign 0.00
R5748:Invs UTSW 4 48,307,823 (GRCm39) missense probably damaging 0.98
R5813:Invs UTSW 4 48,398,146 (GRCm39) missense probably damaging 0.98
R5840:Invs UTSW 4 48,396,284 (GRCm39) missense probably damaging 1.00
R5984:Invs UTSW 4 48,421,674 (GRCm39) missense probably benign 0.00
R6513:Invs UTSW 4 48,397,534 (GRCm39) missense possibly damaging 0.46
R6637:Invs UTSW 4 48,416,203 (GRCm39) splice site probably null
R6667:Invs UTSW 4 48,402,870 (GRCm39) missense possibly damaging 0.66
R6838:Invs UTSW 4 48,283,278 (GRCm39) missense possibly damaging 0.95
R6921:Invs UTSW 4 48,396,260 (GRCm39) missense possibly damaging 0.46
R6945:Invs UTSW 4 48,421,785 (GRCm39) missense probably benign 0.00
R7102:Invs UTSW 4 48,407,674 (GRCm39) missense probably benign 0.21
R7142:Invs UTSW 4 48,407,696 (GRCm39) missense probably damaging 1.00
R7263:Invs UTSW 4 48,396,381 (GRCm39) missense probably damaging 1.00
R7283:Invs UTSW 4 48,392,526 (GRCm39) splice site probably null
R7461:Invs UTSW 4 48,392,668 (GRCm39) missense probably damaging 1.00
R7503:Invs UTSW 4 48,396,347 (GRCm39) missense probably damaging 0.96
R7581:Invs UTSW 4 48,421,909 (GRCm39) missense probably benign 0.00
R7613:Invs UTSW 4 48,392,668 (GRCm39) missense probably damaging 1.00
R7861:Invs UTSW 4 48,397,559 (GRCm39) missense possibly damaging 0.50
R8316:Invs UTSW 4 48,426,199 (GRCm39) missense possibly damaging 0.68
R8321:Invs UTSW 4 48,283,267 (GRCm39) missense probably benign 0.13
R8500:Invs UTSW 4 48,422,109 (GRCm39) missense probably damaging 1.00
R8544:Invs UTSW 4 48,397,598 (GRCm39) missense probably damaging 0.96
R9171:Invs UTSW 4 48,398,149 (GRCm39) missense possibly damaging 0.90
R9663:Invs UTSW 4 48,426,218 (GRCm39) missense probably damaging 1.00
X0026:Invs UTSW 4 48,398,221 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GTGCTGATCAGAGTTCTCTCC -3'
(R):5'- CCACTGTCCTAAGCTCACTG -3'

Sequencing Primer
(F):5'- GATCAGAGTTCTCTCCACCGTCAC -3'
(R):5'- TGTCCTAAGCTCACTGGGACAC -3'
Posted On 2014-06-23