Incidental Mutation 'R1843:Pax7'
ID207412
Institutional Source Beutler Lab
Gene Symbol Pax7
Ensembl Gene ENSMUSG00000028736
Gene Namepaired box 7
SynonymsPax-7
MMRRC Submission 039868-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1843 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location139737062-139833528 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 139784491 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 260 (R260C)
Ref Sequence ENSEMBL: ENSMUSP00000133536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030508] [ENSMUST00000174681]
Predicted Effect probably damaging
Transcript: ENSMUST00000030508
AA Change: R258C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030508
Gene: ENSMUSG00000028736
AA Change: R258C

DomainStartEndE-ValueType
PAX 34 159 2.07e-89 SMART
low complexity region 163 181 N/A INTRINSIC
HOX 215 277 1.46e-28 SMART
Pfam:Pax7 342 383 1.1e-23 PFAM
low complexity region 413 427 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174681
AA Change: R260C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133536
Gene: ENSMUSG00000028736
AA Change: R260C

DomainStartEndE-ValueType
PAX 34 161 1.3e-86 SMART
low complexity region 165 183 N/A INTRINSIC
HOX 217 279 1.46e-28 SMART
Pfam:Pax7 345 385 1.3e-22 PFAM
low complexity region 415 429 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the paired box (PAX) family of transcription factors. Members of this gene family typically contain a paired box domain, an octapeptide, and a paired-type homeodomain. These genes play critical roles during fetal development and cancer growth. The specific function of the paired box 7 gene is unknown but speculated to involve tumor suppression since fusion of this gene with a forkhead domain family member has been associated with alveolar rhabdomyosarcoma. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit craniofacial malformations involving the nose and maxilla, and die within three weeks after birth. Mice homozygous for floxed alleles activated in muscle cells exhibit reduced satellite cell numbers and impaired muscle regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik C T 8: 105,708,974 T88M probably damaging Het
9130011E15Rik A C 19: 45,975,252 S42R probably benign Het
9430038I01Rik A G 7: 137,377,066 probably benign Het
Adgra3 A C 5: 49,961,492 S905A probably damaging Het
Adgrv1 A G 13: 81,544,533 Y1618H probably damaging Het
Anapc15-ps T C 10: 95,673,314 T26A probably benign Het
Ankrd13d T C 19: 4,271,595 K360E probably damaging Het
Anks1b T A 10: 90,512,889 probably null Het
Apob T C 12: 8,007,602 F2028S possibly damaging Het
Arap3 G A 18: 37,975,583 R1265W probably damaging Het
Arhgef37 A G 18: 61,518,050 Y135H probably damaging Het
Atp1a1 T C 3: 101,582,017 T760A probably benign Het
Cdc42bpb T A 12: 111,322,821 M497L probably benign Het
Ces5a C T 8: 93,514,231 V413M probably damaging Het
Chd5 A T 4: 152,385,806 Y1903F probably damaging Het
Chd9 T A 8: 91,010,794 N1500K probably benign Het
Chmp7 G T 14: 69,719,799 D303E probably benign Het
Chrnb4 A T 9: 55,034,818 Y391N possibly damaging Het
Crtc1 T C 8: 70,388,152 T475A probably benign Het
Cyp2c69 A G 19: 39,877,528 I207T probably benign Het
Dcp1a A G 14: 30,518,983 E250G probably damaging Het
Ddx20 T C 3: 105,679,082 Q649R probably benign Het
Defb12 T A 8: 19,112,738 K59N probably damaging Het
Dpy19l3 A T 7: 35,729,760 I85N probably damaging Het
Duox2 C T 2: 122,292,258 probably null Het
E430018J23Rik A C 7: 127,391,488 D442E probably benign Het
Ebi3 T A 17: 55,956,679 Y197N probably damaging Het
Emc1 G A 4: 139,375,512 R994Q probably benign Het
Ercc6 G T 14: 32,546,820 M530I probably damaging Het
Evl T A 12: 108,652,996 D70E probably damaging Het
Fam35a A G 14: 34,267,803 I382T probably benign Het
Fbln2 A G 6: 91,265,775 N819S probably damaging Het
Foxk2 A G 11: 121,285,537 I170V probably benign Het
Gfm1 T C 3: 67,435,610 V159A probably damaging Het
Gm10837 A G 14: 122,490,765 T18A unknown Het
Gm12887 A T 4: 121,622,030 V25E probably damaging Het
Hectd4 A G 5: 121,297,180 H985R possibly damaging Het
Hsfy2 A G 1: 56,636,632 Y249H possibly damaging Het
Hspg2 T C 4: 137,545,567 V2639A probably damaging Het
Igf2r A G 17: 12,704,270 probably null Het
Invs T A 4: 48,422,035 I889N probably damaging Het
Kcnq1 A T 7: 143,183,120 M209L probably benign Het
Klra7 A G 6: 130,229,994 I48T possibly damaging Het
Krt26 CTAGTA CTA 11: 99,333,526 probably benign Het
Lrif1 T A 3: 106,732,811 V404D probably damaging Het
Lrriq1 T A 10: 103,227,173 probably null Het
Lypd6 T A 2: 50,188,762 I90N possibly damaging Het
Mbp A G 18: 82,584,122 D174G probably damaging Het
Megf9 G T 4: 70,534,785 P13Q probably damaging Het
Myo15b A T 11: 115,869,586 T1155S probably benign Het
Nlrp6 T A 7: 140,923,093 C371S probably damaging Het
Nosip T A 7: 45,077,309 probably null Het
Nox3 G T 17: 3,669,878 P344H probably damaging Het
Nup210l T C 3: 90,172,086 V959A probably damaging Het
Olfr1360 C A 13: 21,674,672 V91L probably benign Het
Olfr1475 A G 19: 13,479,931 I89T probably benign Het
Olfr175-ps1 T A 16: 58,824,077 I211F probably damaging Het
Olfr267 T C 4: 58,785,384 I113V probably benign Het
Olfr959 A G 9: 39,572,735 Y175H possibly damaging Het
Osbpl3 A C 6: 50,370,143 S25A probably damaging Het
Otog G A 7: 46,246,283 C107Y probably damaging Het
Pbrm1 A T 14: 31,038,957 I224F probably damaging Het
Pcdh1 T A 18: 38,192,225 probably null Het
Pcnx T C 12: 81,980,935 L1585P probably damaging Het
Pde4c C T 8: 70,747,950 H362Y probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pgm2 A T 4: 99,961,478 Q90L probably damaging Het
Phlpp1 A G 1: 106,343,505 H814R probably benign Het
Pknox2 A T 9: 36,954,831 M5K possibly damaging Het
Pole G A 5: 110,330,835 probably null Het
Polr1b A G 2: 129,102,966 I61V probably benign Het
Prelp T C 1: 133,914,757 K217E probably damaging Het
Prkce C T 17: 86,475,546 Q202* probably null Het
Psmd2 T G 16: 20,656,582 M370R probably benign Het
Rimklb A T 6: 122,464,009 H68Q probably damaging Het
Rnasel A G 1: 153,754,674 D312G possibly damaging Het
Rxrg A T 1: 167,598,752 M1L probably benign Het
Scrn1 A G 6: 54,522,841 F220L possibly damaging Het
Scyl3 A G 1: 163,950,675 S461G probably benign Het
Serpina1c T A 12: 103,895,023 T411S probably benign Het
Serpinb6d C T 13: 33,671,381 P346L probably benign Het
Slc9a3r2 C T 17: 24,641,719 S150N possibly damaging Het
Spg21 G T 9: 65,465,336 V17F probably damaging Het
Spink5 A T 18: 43,999,891 M525L probably benign Het
Sun2 T C 15: 79,737,563 T155A probably benign Het
Tchh T A 3: 93,446,780 F1176I unknown Het
Tex15 T A 8: 33,576,654 D2037E probably benign Het
Tfdp2 T C 9: 96,317,804 C392R possibly damaging Het
Tmem30c T C 16: 57,276,780 N139S probably benign Het
Tns2 C T 15: 102,113,133 probably null Het
Trim66 T C 7: 109,475,839 E405G probably damaging Het
Trpc4 T A 3: 54,279,994 F456I probably benign Het
Tspo2 T C 17: 48,448,790 D108G possibly damaging Het
Tyk2 A T 9: 21,121,554 C304* probably null Het
Vgll4 A T 6: 114,862,795 S185T probably benign Het
Vmn2r94 A C 17: 18,244,470 S519R probably benign Het
Vmn2r96 T G 17: 18,597,921 S587A probably benign Het
Vps4b C A 1: 106,778,982 A287S possibly damaging Het
Yeats2 C T 16: 20,229,564 P1332S probably benign Het
Zfp462 T G 4: 55,010,010 S659A possibly damaging Het
Zfp507 C T 7: 35,793,725 R631Q probably damaging Het
Zswim5 G T 4: 116,877,699 E80D unknown Het
Other mutations in Pax7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02234:Pax7 APN 4 139828590 missense probably damaging 0.97
IGL03005:Pax7 APN 4 139828696 missense probably damaging 1.00
IGL03143:Pax7 APN 4 139829487 splice site probably benign
R0266:Pax7 UTSW 4 139779736 missense possibly damaging 0.79
R1891:Pax7 UTSW 4 139784626 missense probably damaging 1.00
R2847:Pax7 UTSW 4 139779643 missense possibly damaging 0.90
R2909:Pax7 UTSW 4 139828696 missense possibly damaging 0.62
R3912:Pax7 UTSW 4 139780898 missense probably benign 0.41
R4516:Pax7 UTSW 4 139780793 missense probably benign 0.00
R5060:Pax7 UTSW 4 139779617 missense probably benign 0.00
R5060:Pax7 UTSW 4 139829595 missense probably damaging 1.00
R5089:Pax7 UTSW 4 139830265 missense probably damaging 0.98
R5809:Pax7 UTSW 4 139830371 missense probably damaging 1.00
R7367:Pax7 UTSW 4 139779749 missense probably benign 0.04
R7485:Pax7 UTSW 4 139784569 missense probably benign 0.36
R7823:Pax7 UTSW 4 139740839 missense probably benign 0.20
Z1177:Pax7 UTSW 4 139784491 missense probably damaging 0.98
Z1177:Pax7 UTSW 4 139784515 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TGGAGAGTTTGTGCCTTCCC -3'
(R):5'- TGTGGAATCAGAACCCGAC -3'

Sequencing Primer
(F):5'- TCTGTCAATCTGTAAGTCAATCAACC -3'
(R):5'- CCTCCCCCTGAAGCGCAAG -3'
Posted On2014-06-23