Incidental Mutation 'R1843:Adgra3'
ID 207414
Institutional Source Beutler Lab
Gene Symbol Adgra3
Ensembl Gene ENSMUSG00000029090
Gene Name adhesion G protein-coupled receptor A3
Synonyms Tem5-like, 3830613O22Rik, Gpr125
MMRRC Submission 039868-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1843 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 50117293-50216338 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 50118834 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 905 (S905A)
Ref Sequence ENSEMBL: ENSMUSP00000030971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030971]
AlphaFold Q7TT36
Predicted Effect probably damaging
Transcript: ENSMUST00000030971
AA Change: S905A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030971
Gene: ENSMUSG00000029090
AA Change: S905A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 36 48 N/A INTRINSIC
LRR 68 92 1.71e1 SMART
LRR_TYP 93 116 2.27e-4 SMART
LRR_TYP 117 140 4.11e-2 SMART
LRR_TYP 141 164 3.89e-3 SMART
LRRCT 176 225 5.24e-5 SMART
IG 238 331 8.26e-5 SMART
GPS 686 738 4.81e-3 SMART
Pfam:7tm_2 746 1031 1.6e-16 PFAM
low complexity region 1251 1262 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196177
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G protein-coupled receptor superfamily. This membrane protein may play a role in tumor angiogenesis through its interaction with the human homolog of the Drosophila disc large tumor suppressor gene. This gene is mapped to a candidate region of chromosome 4 which may be associated with bipolar disorder and schizophrenia. [provided by RefSeq, Oct 2012]
PHENOTYPE: Homozygous mutant mice are fertile and grossly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik C T 8: 106,435,606 (GRCm39) T88M probably damaging Het
9430038I01Rik A G 7: 136,978,795 (GRCm39) probably benign Het
Adgrv1 A G 13: 81,692,652 (GRCm39) Y1618H probably damaging Het
Anapc15-ps T C 10: 95,509,176 (GRCm39) T26A probably benign Het
Ankrd13d T C 19: 4,321,623 (GRCm39) K360E probably damaging Het
Anks1b T A 10: 90,348,751 (GRCm39) probably null Het
Apob T C 12: 8,057,602 (GRCm39) F2028S possibly damaging Het
Arap3 G A 18: 38,108,636 (GRCm39) R1265W probably damaging Het
Arhgef37 A G 18: 61,651,121 (GRCm39) Y135H probably damaging Het
Armh3 A C 19: 45,963,691 (GRCm39) S42R probably benign Het
Atp1a1 T C 3: 101,489,333 (GRCm39) T760A probably benign Het
Cdc42bpb T A 12: 111,289,255 (GRCm39) M497L probably benign Het
Ces5a C T 8: 94,240,859 (GRCm39) V413M probably damaging Het
Chd5 A T 4: 152,470,263 (GRCm39) Y1903F probably damaging Het
Chd9 T A 8: 91,737,422 (GRCm39) N1500K probably benign Het
Chmp7 G T 14: 69,957,248 (GRCm39) D303E probably benign Het
Chrnb4 A T 9: 54,942,102 (GRCm39) Y391N possibly damaging Het
Crtc1 T C 8: 70,840,802 (GRCm39) T475A probably benign Het
Cyp2c69 A G 19: 39,865,972 (GRCm39) I207T probably benign Het
Dcp1a A G 14: 30,240,940 (GRCm39) E250G probably damaging Het
Ddx20 T C 3: 105,586,398 (GRCm39) Q649R probably benign Het
Defb12 T A 8: 19,162,754 (GRCm39) K59N probably damaging Het
Dpy19l3 A T 7: 35,429,185 (GRCm39) I85N probably damaging Het
Duox2 C T 2: 122,122,739 (GRCm39) probably null Het
Ebi3 T A 17: 56,263,679 (GRCm39) Y197N probably damaging Het
Emc1 G A 4: 139,102,823 (GRCm39) R994Q probably benign Het
Ercc6 G T 14: 32,268,777 (GRCm39) M530I probably damaging Het
Evl T A 12: 108,619,255 (GRCm39) D70E probably damaging Het
Fbln2 A G 6: 91,242,757 (GRCm39) N819S probably damaging Het
Foxk2 A G 11: 121,176,363 (GRCm39) I170V probably benign Het
Gfm1 T C 3: 67,342,943 (GRCm39) V159A probably damaging Het
Gm10837 A G 14: 122,728,177 (GRCm39) T18A unknown Het
Gm12887 A T 4: 121,479,227 (GRCm39) V25E probably damaging Het
Hectd4 A G 5: 121,435,243 (GRCm39) H985R possibly damaging Het
Hsfy2 A G 1: 56,675,791 (GRCm39) Y249H possibly damaging Het
Hspg2 T C 4: 137,272,878 (GRCm39) V2639A probably damaging Het
Igf2r A G 17: 12,923,157 (GRCm39) probably null Het
Invs T A 4: 48,422,035 (GRCm39) I889N probably damaging Het
Kcnq1 A T 7: 142,736,857 (GRCm39) M209L probably benign Het
Klra7 A G 6: 130,206,957 (GRCm39) I48T possibly damaging Het
Krt26 CTAGTA CTA 11: 99,224,352 (GRCm39) probably benign Het
Lrif1 T A 3: 106,640,127 (GRCm39) V404D probably damaging Het
Lrriq1 T A 10: 103,063,034 (GRCm39) probably null Het
Lypd6 T A 2: 50,078,774 (GRCm39) I90N possibly damaging Het
Mbp A G 18: 82,602,247 (GRCm39) D174G probably damaging Het
Megf9 G T 4: 70,453,022 (GRCm39) P13Q probably damaging Het
Myo15b A T 11: 115,760,412 (GRCm39) T1155S probably benign Het
Nherf2 C T 17: 24,860,693 (GRCm39) S150N possibly damaging Het
Nlrp6 T A 7: 140,503,006 (GRCm39) C371S probably damaging Het
Nosip T A 7: 44,726,733 (GRCm39) probably null Het
Nox3 G T 17: 3,720,153 (GRCm39) P344H probably damaging Het
Nup210l T C 3: 90,079,393 (GRCm39) V959A probably damaging Het
Or10d1 A G 9: 39,484,031 (GRCm39) Y175H possibly damaging Het
Or2b2b C A 13: 21,858,842 (GRCm39) V91L probably benign Het
Or2k2 T C 4: 58,785,384 (GRCm39) I113V probably benign Het
Or5b119 A G 19: 13,457,295 (GRCm39) I89T probably benign Het
Or5k8 T A 16: 58,644,440 (GRCm39) I211F probably damaging Het
Osbpl3 A C 6: 50,347,123 (GRCm39) S25A probably damaging Het
Otog G A 7: 45,895,707 (GRCm39) C107Y probably damaging Het
Pax7 G A 4: 139,511,802 (GRCm39) R260C probably damaging Het
Pbrm1 A T 14: 30,760,914 (GRCm39) I224F probably damaging Het
Pcdh1 T A 18: 38,325,278 (GRCm39) probably null Het
Pcnx1 T C 12: 82,027,709 (GRCm39) L1585P probably damaging Het
Pde4c C T 8: 71,200,599 (GRCm39) H362Y probably damaging Het
Pdlim2 C T 14: 70,402,228 (GRCm39) R296H probably damaging Het
Pgm1 A T 4: 99,818,675 (GRCm39) Q90L probably damaging Het
Phlpp1 A G 1: 106,271,235 (GRCm39) H814R probably benign Het
Pknox2 A T 9: 36,866,127 (GRCm39) M5K possibly damaging Het
Pole G A 5: 110,478,701 (GRCm39) probably null Het
Polr1b A G 2: 128,944,886 (GRCm39) I61V probably benign Het
Prelp T C 1: 133,842,495 (GRCm39) K217E probably damaging Het
Prkce C T 17: 86,782,974 (GRCm39) Q202* probably null Het
Psmd2 T G 16: 20,475,332 (GRCm39) M370R probably benign Het
Rimklb A T 6: 122,440,968 (GRCm39) H68Q probably damaging Het
Rnasel A G 1: 153,630,420 (GRCm39) D312G possibly damaging Het
Rxrg A T 1: 167,426,321 (GRCm39) M1L probably benign Het
Scrn1 A G 6: 54,499,826 (GRCm39) F220L possibly damaging Het
Scyl3 A G 1: 163,778,244 (GRCm39) S461G probably benign Het
Serpina1c T A 12: 103,861,282 (GRCm39) T411S probably benign Het
Serpinb6d C T 13: 33,855,364 (GRCm39) P346L probably benign Het
Shld2 A G 14: 33,989,760 (GRCm39) I382T probably benign Het
Spg21 G T 9: 65,372,618 (GRCm39) V17F probably damaging Het
Spink5 A T 18: 44,132,958 (GRCm39) M525L probably benign Het
Sun2 T C 15: 79,621,764 (GRCm39) T155A probably benign Het
Tchh T A 3: 93,354,087 (GRCm39) F1176I unknown Het
Tex15 T A 8: 34,066,682 (GRCm39) D2037E probably benign Het
Tfdp2 T C 9: 96,199,857 (GRCm39) C392R possibly damaging Het
Tmem30c T C 16: 57,097,143 (GRCm39) N139S probably benign Het
Tns2 C T 15: 102,021,568 (GRCm39) probably null Het
Trim66 T C 7: 109,075,046 (GRCm39) E405G probably damaging Het
Trpc4 T A 3: 54,187,415 (GRCm39) F456I probably benign Het
Tspo2 T C 17: 48,755,818 (GRCm39) D108G possibly damaging Het
Tyk2 A T 9: 21,032,850 (GRCm39) C304* probably null Het
Vgll4 A T 6: 114,839,756 (GRCm39) S185T probably benign Het
Vmn2r94 A C 17: 18,464,732 (GRCm39) S519R probably benign Het
Vmn2r96 T G 17: 18,818,183 (GRCm39) S587A probably benign Het
Vps4b C A 1: 106,706,712 (GRCm39) A287S possibly damaging Het
Yeats2 C T 16: 20,048,314 (GRCm39) P1332S probably benign Het
Zfp462 T G 4: 55,010,010 (GRCm39) S659A possibly damaging Het
Zfp507 C T 7: 35,493,150 (GRCm39) R631Q probably damaging Het
Zfp764l1 A C 7: 126,990,660 (GRCm39) D442E probably benign Het
Zswim5 G T 4: 116,734,896 (GRCm39) E80D unknown Het
Other mutations in Adgra3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Adgra3 APN 5 50,183,100 (GRCm39) missense probably damaging 1.00
IGL00848:Adgra3 APN 5 50,159,291 (GRCm39) missense probably damaging 1.00
IGL01455:Adgra3 APN 5 50,144,899 (GRCm39) nonsense probably null
IGL01665:Adgra3 APN 5 50,164,272 (GRCm39) missense possibly damaging 0.64
IGL02151:Adgra3 APN 5 50,136,484 (GRCm39) missense probably benign
IGL02239:Adgra3 APN 5 50,118,054 (GRCm39) missense probably damaging 1.00
IGL02351:Adgra3 APN 5 50,215,900 (GRCm39) missense probably benign 0.19
IGL02358:Adgra3 APN 5 50,215,900 (GRCm39) missense probably benign 0.19
IGL02938:Adgra3 APN 5 50,118,659 (GRCm39) missense probably benign 0.01
IGL03028:Adgra3 APN 5 50,174,194 (GRCm39) missense probably benign 0.30
aperture UTSW 5 50,156,487 (GRCm39) nonsense probably null
saltatory UTSW 5 50,117,901 (GRCm39) missense probably benign 0.09
ANU74:Adgra3 UTSW 5 50,118,380 (GRCm39) missense probably benign 0.16
R0041:Adgra3 UTSW 5 50,117,901 (GRCm39) missense probably benign 0.09
R0041:Adgra3 UTSW 5 50,117,901 (GRCm39) missense probably benign 0.09
R0121:Adgra3 UTSW 5 50,183,128 (GRCm39) splice site probably benign
R0125:Adgra3 UTSW 5 50,159,194 (GRCm39) splice site probably benign
R0137:Adgra3 UTSW 5 50,121,182 (GRCm39) splice site probably benign
R0415:Adgra3 UTSW 5 50,119,099 (GRCm39) splice site probably benign
R0479:Adgra3 UTSW 5 50,147,607 (GRCm39) missense probably benign 0.00
R0505:Adgra3 UTSW 5 50,166,676 (GRCm39) critical splice donor site probably null
R0831:Adgra3 UTSW 5 50,128,144 (GRCm39) missense probably damaging 1.00
R0883:Adgra3 UTSW 5 50,118,065 (GRCm39) missense probably damaging 1.00
R0920:Adgra3 UTSW 5 50,118,503 (GRCm39) missense probably benign 0.19
R1139:Adgra3 UTSW 5 50,119,097 (GRCm39) splice site probably null
R1211:Adgra3 UTSW 5 50,164,218 (GRCm39) missense possibly damaging 0.88
R1370:Adgra3 UTSW 5 50,118,129 (GRCm39) missense possibly damaging 0.56
R1530:Adgra3 UTSW 5 50,118,479 (GRCm39) missense probably benign 0.00
R1703:Adgra3 UTSW 5 50,164,117 (GRCm39) missense probably benign 0.00
R1782:Adgra3 UTSW 5 50,129,404 (GRCm39) missense probably benign 0.02
R2157:Adgra3 UTSW 5 50,159,283 (GRCm39) missense possibly damaging 0.87
R2281:Adgra3 UTSW 5 50,159,222 (GRCm39) missense probably benign 0.04
R2385:Adgra3 UTSW 5 50,136,908 (GRCm39) missense possibly damaging 0.95
R2426:Adgra3 UTSW 5 50,166,791 (GRCm39) missense possibly damaging 0.61
R3084:Adgra3 UTSW 5 50,170,733 (GRCm39) critical splice donor site probably null
R3086:Adgra3 UTSW 5 50,170,733 (GRCm39) critical splice donor site probably null
R3409:Adgra3 UTSW 5 50,159,272 (GRCm39) missense probably damaging 1.00
R3410:Adgra3 UTSW 5 50,159,272 (GRCm39) missense probably damaging 1.00
R3411:Adgra3 UTSW 5 50,159,272 (GRCm39) missense probably damaging 1.00
R4301:Adgra3 UTSW 5 50,118,420 (GRCm39) missense possibly damaging 0.94
R4360:Adgra3 UTSW 5 50,147,552 (GRCm39) missense possibly damaging 0.92
R4475:Adgra3 UTSW 5 50,159,240 (GRCm39) missense probably damaging 1.00
R4569:Adgra3 UTSW 5 50,117,905 (GRCm39) missense probably damaging 1.00
R4607:Adgra3 UTSW 5 50,128,081 (GRCm39) missense probably damaging 0.98
R4667:Adgra3 UTSW 5 50,136,298 (GRCm39) missense possibly damaging 0.94
R4671:Adgra3 UTSW 5 50,136,710 (GRCm39) missense probably damaging 1.00
R4886:Adgra3 UTSW 5 50,156,537 (GRCm39) missense probably benign 0.07
R5197:Adgra3 UTSW 5 50,118,096 (GRCm39) missense probably benign 0.01
R5208:Adgra3 UTSW 5 50,168,857 (GRCm39) missense probably damaging 0.99
R5313:Adgra3 UTSW 5 50,118,651 (GRCm39) missense probably benign 0.24
R5435:Adgra3 UTSW 5 50,147,468 (GRCm39) missense probably damaging 0.99
R5663:Adgra3 UTSW 5 50,156,627 (GRCm39) missense probably benign 0.14
R6038:Adgra3 UTSW 5 50,156,487 (GRCm39) nonsense probably null
R6038:Adgra3 UTSW 5 50,156,487 (GRCm39) nonsense probably null
R6064:Adgra3 UTSW 5 50,117,667 (GRCm39) missense probably damaging 0.97
R6259:Adgra3 UTSW 5 50,156,483 (GRCm39) missense possibly damaging 0.63
R6272:Adgra3 UTSW 5 50,166,791 (GRCm39) missense possibly damaging 0.61
R6293:Adgra3 UTSW 5 50,118,189 (GRCm39) missense probably benign 0.21
R6296:Adgra3 UTSW 5 50,118,189 (GRCm39) missense probably benign 0.21
R6297:Adgra3 UTSW 5 50,118,189 (GRCm39) missense probably benign 0.21
R6352:Adgra3 UTSW 5 50,147,592 (GRCm39) missense probably benign 0.01
R6352:Adgra3 UTSW 5 50,136,478 (GRCm39) missense probably benign
R6989:Adgra3 UTSW 5 50,164,226 (GRCm39) missense probably damaging 1.00
R7026:Adgra3 UTSW 5 50,118,083 (GRCm39) missense probably benign
R7147:Adgra3 UTSW 5 50,118,587 (GRCm39) missense probably damaging 1.00
R7206:Adgra3 UTSW 5 50,164,238 (GRCm39) missense probably damaging 1.00
R7381:Adgra3 UTSW 5 50,216,116 (GRCm39) start codon destroyed probably null
R7508:Adgra3 UTSW 5 50,174,209 (GRCm39) missense probably benign 0.10
R7538:Adgra3 UTSW 5 50,118,792 (GRCm39) missense probably benign 0.01
R7579:Adgra3 UTSW 5 50,144,977 (GRCm39) missense probably benign
R7951:Adgra3 UTSW 5 50,121,126 (GRCm39) missense probably damaging 1.00
R8269:Adgra3 UTSW 5 50,121,079 (GRCm39) missense probably damaging 0.98
R8458:Adgra3 UTSW 5 50,145,013 (GRCm39) missense probably damaging 0.99
R8486:Adgra3 UTSW 5 50,147,621 (GRCm39) missense probably damaging 0.98
R8912:Adgra3 UTSW 5 50,118,273 (GRCm39) missense possibly damaging 0.61
R8955:Adgra3 UTSW 5 50,118,731 (GRCm39) missense probably benign 0.05
R9108:Adgra3 UTSW 5 50,136,295 (GRCm39) missense probably damaging 1.00
R9112:Adgra3 UTSW 5 50,118,395 (GRCm39) missense probably damaging 1.00
R9191:Adgra3 UTSW 5 50,145,006 (GRCm39) missense possibly damaging 0.88
R9267:Adgra3 UTSW 5 50,155,618 (GRCm39) missense possibly damaging 0.87
R9312:Adgra3 UTSW 5 50,117,900 (GRCm39) missense probably damaging 1.00
R9537:Adgra3 UTSW 5 50,118,207 (GRCm39) missense possibly damaging 0.82
R9614:Adgra3 UTSW 5 50,164,250 (GRCm39) missense probably damaging 1.00
RF005:Adgra3 UTSW 5 50,170,729 (GRCm39) splice site probably null
RF024:Adgra3 UTSW 5 50,170,729 (GRCm39) splice site probably null
RF036:Adgra3 UTSW 5 50,215,983 (GRCm39) small deletion probably benign
X0065:Adgra3 UTSW 5 50,129,304 (GRCm39) missense probably benign
Z1187:Adgra3 UTSW 5 50,136,421 (GRCm39) missense probably damaging 1.00
Z1192:Adgra3 UTSW 5 50,156,623 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTCCTGATGGTTGATTTCACC -3'
(R):5'- GGATCCCCATCATAGTGTGTGG -3'

Sequencing Primer
(F):5'- GGTTGATTTCACCATTTTCATTGGC -3'
(R):5'- CCATCATAGTGTGTGGTATCACCG -3'
Posted On 2014-06-23