Mutagenetix > Incidental Mutation

Incidental Mutation 'R1843:Otog'

207428

Institutional Source

Beutler Lab

Gene Symbol

Otog

Ensembl Gene

ENSMUSG00000009487

Gene Name

otogelin

Synonyms

Otgn

MMRRC Submission

039868-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.813) question?

Stock #

R1843 (G1)

Quality Score

213

Status

Not validated

Chromosome

Chromosomal Location

46240987-46311434 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 46246283 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tyrosine at position 107 (C107Y)

Ref Sequence

ENSEMBL: ENSMUSP00000130949 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000164538]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000164538
AA Change: C107Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000130949
Gene: ENSMUSG00000009487
AA Change: C107Y

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
low complexity region	72	85	N/A	INTRINSIC
VWD	128	288	7.98e-45	SMART
C8	330	404	1.05e-13	SMART
VWC	463	505	1.24e0	SMART
VWD	490	655	4.94e-50	SMART
C8	693	758	1.23e-5	SMART
Pfam:TIL	767	831	3.4e-13	PFAM
VWC	935	983	1.83e0	SMART
VWD	962	1118	6.05e-45	SMART
C8	1153	1227	1.02e-34	SMART
Pfam:AbfB	1270	1384	7.5e-10	PFAM
low complexity region	1488	1513	N/A	INTRINSIC
low complexity region	1524	1536	N/A	INTRINSIC
low complexity region	1560	1578	N/A	INTRINSIC
low complexity region	1637	1644	N/A	INTRINSIC
low complexity region	1677	1696	N/A	INTRINSIC
low complexity region	1731	1748	N/A	INTRINSIC
VWD	2087	2251	2.37e-29	SMART
C8	2287	2356	4.93e-19	SMART
low complexity region	2443	2449	N/A	INTRINSIC
CT	2828	2911	3.46e-28	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210281

Meta Mutation Damage Score

0.7246

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.3%
20x: 92.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the acellular membranes of the inner ear. Disruption of the orthologous mouse gene shows that it plays a role in auditory and vestibular functions. It is involved in fibrillar network organization, the anchoring of otoconial membranes and cupulae to the neuroepithelia, and likely in sound stimulation resistance. Mutations in this gene cause autosomal recessive nonsyndromic deafness, type 18B. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygotes for a number of different spontaneous and targeted mutations exhibit vestibular dysfunction, including circling, head tilt, impaired balance, coordination, and placing response. Mutants have impaired hearing, decreased brain stem auditory evoked potential, and ear abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 102 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933405L10Rik	C	T	8: 105,708,974	T88M	probably damaging	Het
9130011E15Rik	A	C	19: 45,975,252	S42R	probably benign	Het
9430038I01Rik	A	G	7: 137,377,066		probably benign	Het
Adgra3	A	C	5: 49,961,492	S905A	probably damaging	Het
Adgrv1	A	G	13: 81,544,533	Y1618H	probably damaging	Het
Anapc15-ps	T	C	10: 95,673,314	T26A	probably benign	Het
Ankrd13d	T	C	19: 4,271,595	K360E	probably damaging	Het
Anks1b	T	A	10: 90,512,889		probably null	Het
Apob	T	C	12: 8,007,602	F2028S	possibly damaging	Het
Arap3	G	A	18: 37,975,583	R1265W	probably damaging	Het
Arhgef37	A	G	18: 61,518,050	Y135H	probably damaging	Het
Atp1a1	T	C	3: 101,582,017	T760A	probably benign	Het
Cdc42bpb	T	A	12: 111,322,821	M497L	probably benign	Het
Ces5a	C	T	8: 93,514,231	V413M	probably damaging	Het
Chd5	A	T	4: 152,385,806	Y1903F	probably damaging	Het
Chd9	T	A	8: 91,010,794	N1500K	probably benign	Het
Chmp7	G	T	14: 69,719,799	D303E	probably benign	Het
Chrnb4	A	T	9: 55,034,818	Y391N	possibly damaging	Het
Crtc1	T	C	8: 70,388,152	T475A	probably benign	Het
Cyp2c69	A	G	19: 39,877,528	I207T	probably benign	Het
Dcp1a	A	G	14: 30,518,983	E250G	probably damaging	Het
Ddx20	T	C	3: 105,679,082	Q649R	probably benign	Het
Defb12	T	A	8: 19,112,738	K59N	probably damaging	Het
Dpy19l3	A	T	7: 35,729,760	I85N	probably damaging	Het
Duox2	C	T	2: 122,292,258		probably null	Het
E430018J23Rik	A	C	7: 127,391,488	D442E	probably benign	Het
Ebi3	T	A	17: 55,956,679	Y197N	probably damaging	Het
Emc1	G	A	4: 139,375,512	R994Q	probably benign	Het
Ercc6	G	T	14: 32,546,820	M530I	probably damaging	Het
Evl	T	A	12: 108,652,996	D70E	probably damaging	Het
Fam35a	A	G	14: 34,267,803	I382T	probably benign	Het
Fbln2	A	G	6: 91,265,775	N819S	probably damaging	Het
Foxk2	A	G	11: 121,285,537	I170V	probably benign	Het
Gfm1	T	C	3: 67,435,610	V159A	probably damaging	Het
Gm10837	A	G	14: 122,490,765	T18A	unknown	Het
Gm12887	A	T	4: 121,622,030	V25E	probably damaging	Het
Hectd4	A	G	5: 121,297,180	H985R	possibly damaging	Het
Hsfy2	A	G	1: 56,636,632	Y249H	possibly damaging	Het
Hspg2	T	C	4: 137,545,567	V2639A	probably damaging	Het
Igf2r	A	G	17: 12,704,270		probably null	Het
Invs	T	A	4: 48,422,035	I889N	probably damaging	Het
Kcnq1	A	T	7: 143,183,120	M209L	probably benign	Het
Klra7	A	G	6: 130,229,994	I48T	possibly damaging	Het
Krt26	CTAGTA	CTA	11: 99,333,526		probably benign	Het
Lrif1	T	A	3: 106,732,811	V404D	probably damaging	Het
Lrriq1	T	A	10: 103,227,173		probably null	Het
Lypd6	T	A	2: 50,188,762	I90N	possibly damaging	Het
Mbp	A	G	18: 82,584,122	D174G	probably damaging	Het
Megf9	G	T	4: 70,534,785	P13Q	probably damaging	Het
Myo15b	A	T	11: 115,869,586	T1155S	probably benign	Het
Nlrp6	T	A	7: 140,923,093	C371S	probably damaging	Het
Nosip	T	A	7: 45,077,309		probably null	Het
Nox3	G	T	17: 3,669,878	P344H	probably damaging	Het
Nup210l	T	C	3: 90,172,086	V959A	probably damaging	Het
Olfr1360	C	A	13: 21,674,672	V91L	probably benign	Het
Olfr1475	A	G	19: 13,479,931	I89T	probably benign	Het
Olfr175-ps1	T	A	16: 58,824,077	I211F	probably damaging	Het
Olfr267	T	C	4: 58,785,384	I113V	probably benign	Het
Olfr959	A	G	9: 39,572,735	Y175H	possibly damaging	Het
Osbpl3	A	C	6: 50,370,143	S25A	probably damaging	Het
Pax7	G	A	4: 139,784,491	R260C	probably damaging	Het
Pbrm1	A	T	14: 31,038,957	I224F	probably damaging	Het
Pcdh1	T	A	18: 38,192,225		probably null	Het
Pcnx	T	C	12: 81,980,935	L1585P	probably damaging	Het
Pde4c	C	T	8: 70,747,950	H362Y	probably damaging	Het
Pdlim2	C	T	14: 70,164,779	R296H	probably damaging	Het
Pgm2	A	T	4: 99,961,478	Q90L	probably damaging	Het
Phlpp1	A	G	1: 106,343,505	H814R	probably benign	Het
Pknox2	A	T	9: 36,954,831	M5K	possibly damaging	Het
Pole	G	A	5: 110,330,835		probably null	Het
Polr1b	A	G	2: 129,102,966	I61V	probably benign	Het
Prelp	T	C	1: 133,914,757	K217E	probably damaging	Het
Prkce	C	T	17: 86,475,546	Q202*	probably null	Het
Psmd2	T	G	16: 20,656,582	M370R	probably benign	Het
Rimklb	A	T	6: 122,464,009	H68Q	probably damaging	Het
Rnasel	A	G	1: 153,754,674	D312G	possibly damaging	Het
Rxrg	A	T	1: 167,598,752	M1L	probably benign	Het
Scrn1	A	G	6: 54,522,841	F220L	possibly damaging	Het
Scyl3	A	G	1: 163,950,675	S461G	probably benign	Het
Serpina1c	T	A	12: 103,895,023	T411S	probably benign	Het
Serpinb6d	C	T	13: 33,671,381	P346L	probably benign	Het
Slc9a3r2	C	T	17: 24,641,719	S150N	possibly damaging	Het
Spg21	G	T	9: 65,465,336	V17F	probably damaging	Het
Spink5	A	T	18: 43,999,891	M525L	probably benign	Het
Sun2	T	C	15: 79,737,563	T155A	probably benign	Het
Tchh	T	A	3: 93,446,780	F1176I	unknown	Het
Tex15	T	A	8: 33,576,654	D2037E	probably benign	Het
Tfdp2	T	C	9: 96,317,804	C392R	possibly damaging	Het
Tmem30c	T	C	16: 57,276,780	N139S	probably benign	Het
Tns2	C	T	15: 102,113,133		probably null	Het
Trim66	T	C	7: 109,475,839	E405G	probably damaging	Het
Trpc4	T	A	3: 54,279,994	F456I	probably benign	Het
Tspo2	T	C	17: 48,448,790	D108G	possibly damaging	Het
Tyk2	A	T	9: 21,121,554	C304*	probably null	Het
Vgll4	A	T	6: 114,862,795	S185T	probably benign	Het
Vmn2r94	A	C	17: 18,244,470	S519R	probably benign	Het
Vmn2r96	T	G	17: 18,597,921	S587A	probably benign	Het
Vps4b	C	A	1: 106,778,982	A287S	possibly damaging	Het
Yeats2	C	T	16: 20,229,564	P1332S	probably benign	Het
Zfp462	T	G	4: 55,010,010	S659A	possibly damaging	Het
Zfp507	C	T	7: 35,793,725	R631Q	probably damaging	Het
Zswim5	G	T	4: 116,877,699	E80D	unknown	Het

Other mutations in Otog

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Otog	APN	7	46251282	missense	probably damaging	1.00
IGL00725:Otog	APN	7	46274092	missense	probably damaging	1.00
IGL00757:Otog	APN	7	46290128	missense	probably damaging	1.00
IGL00822:Otog	APN	7	46295880	missense	probably benign	0.24
IGL01354:Otog	APN	7	46289726	missense	probably damaging	1.00
IGL01567:Otog	APN	7	46276615	splice site	probably benign
IGL02034:Otog	APN	7	46295993	nonsense	probably null
IGL02090:Otog	APN	7	46300147	missense	probably damaging	1.00
IGL02132:Otog	APN	7	46305479	missense	probably damaging	0.99
IGL02148:Otog	APN	7	46300587	missense	probably damaging	1.00
IGL02173:Otog	APN	7	46276741	splice site	probably benign
IGL02199:Otog	APN	7	46277351	missense	possibly damaging	0.90
IGL02216:Otog	APN	7	46301468	missense	probably damaging	1.00
IGL02322:Otog	APN	7	46301457	missense	probably benign	0.01
IGL02330:Otog	APN	7	46288069	missense	possibly damaging	0.84
IGL02529:Otog	APN	7	46259957	missense	probably damaging	0.99
IGL02898:Otog	APN	7	46310138	missense	probably damaging	1.00
IGL02970:Otog	APN	7	46295867	missense	probably benign	0.11
IGL03085:Otog	APN	7	46305922	critical splice donor site	probably null
IGL03108:Otog	APN	7	46251338	missense	probably damaging	1.00
IGL03275:Otog	APN	7	46306230	missense	probably damaging	1.00
R0282_Otog_616	UTSW	7	46277493	missense	possibly damaging	0.93
R0636_otog_678	UTSW	7	46264228	critical splice donor site	probably null
R1029_otog_141	UTSW	7	46274595	missense	probably damaging	1.00
BB010:Otog	UTSW	7	46310147	missense	probably damaging	1.00
BB020:Otog	UTSW	7	46310147	missense	probably damaging	1.00
I1329:Otog	UTSW	7	46246503	missense	probably benign	0.02
IGL02984:Otog	UTSW	7	46305508	missense	probably damaging	0.98
PIT4472001:Otog	UTSW	7	46295849	missense	probably damaging	1.00
R0032:Otog	UTSW	7	46288213	nonsense	probably null
R0032:Otog	UTSW	7	46304231	missense	probably damaging	0.97
R0105:Otog	UTSW	7	46288366	missense	possibly damaging	0.79
R0164:Otog	UTSW	7	46304231	missense	probably damaging	0.97
R0164:Otog	UTSW	7	46304231	missense	probably damaging	0.97
R0165:Otog	UTSW	7	46304231	missense	probably damaging	0.97
R0166:Otog	UTSW	7	46304231	missense	probably damaging	0.97
R0167:Otog	UTSW	7	46304231	missense	probably damaging	0.97
R0240:Otog	UTSW	7	46264032	splice site	probably null
R0240:Otog	UTSW	7	46264032	splice site	probably null
R0242:Otog	UTSW	7	46267381	missense	probably damaging	0.98
R0242:Otog	UTSW	7	46267381	missense	probably damaging	0.98
R0282:Otog	UTSW	7	46277493	missense	possibly damaging	0.93
R0392:Otog	UTSW	7	46250075	missense	probably benign	0.00
R0436:Otog	UTSW	7	46265936	splice site	probably benign
R0441:Otog	UTSW	7	46305877	missense	probably damaging	1.00
R0499:Otog	UTSW	7	46273832	missense	probably damaging	1.00
R0530:Otog	UTSW	7	46298244	missense	probably damaging	0.98
R0541:Otog	UTSW	7	46269249	splice site	probably benign
R0600:Otog	UTSW	7	46251395	splice site	probably benign
R0626:Otog	UTSW	7	46271373	missense	possibly damaging	0.95
R0636:Otog	UTSW	7	46264228	critical splice donor site	probably null
R0764:Otog	UTSW	7	46300494	missense	probably benign	0.00
R0833:Otog	UTSW	7	46269362	missense	possibly damaging	0.94
R0836:Otog	UTSW	7	46269362	missense	possibly damaging	0.94
R0844:Otog	UTSW	7	46287828	missense	possibly damaging	0.53
R1029:Otog	UTSW	7	46274595	missense	probably damaging	1.00
R1116:Otog	UTSW	7	46300601	splice site	probably benign
R1134:Otog	UTSW	7	46298514	missense	probably damaging	1.00
R1183:Otog	UTSW	7	46289755	missense	probably benign	0.41
R1204:Otog	UTSW	7	46259911	missense	probably benign	0.16
R1301:Otog	UTSW	7	46289689	missense	probably damaging	1.00
R1344:Otog	UTSW	7	46274615	missense	probably damaging	1.00
R1384:Otog	UTSW	7	46273695	splice site	probably benign
R1418:Otog	UTSW	7	46274615	missense	probably damaging	1.00
R1432:Otog	UTSW	7	46300583	missense	probably damaging	1.00
R1479:Otog	UTSW	7	46295978	missense	possibly damaging	0.75
R1521:Otog	UTSW	7	46259264	missense	possibly damaging	0.71
R1589:Otog	UTSW	7	46283908	missense	probably benign	0.18
R1671:Otog	UTSW	7	46261786	missense	probably damaging	1.00
R1773:Otog	UTSW	7	46288159	missense	probably benign	0.28
R1806:Otog	UTSW	7	46290937	critical splice acceptor site	probably null
R1873:Otog	UTSW	7	46269343	missense	probably damaging	1.00
R1923:Otog	UTSW	7	46246283	missense	probably damaging	1.00
R1927:Otog	UTSW	7	46246283	missense	probably damaging	1.00
R2008:Otog	UTSW	7	46264074	missense	probably benign	0.43
R2048:Otog	UTSW	7	46287639	missense	probably damaging	1.00
R2131:Otog	UTSW	7	46250100	missense	probably damaging	1.00
R2153:Otog	UTSW	7	46302904	missense	probably damaging	1.00
R2240:Otog	UTSW	7	46241029	start codon destroyed	probably null
R2278:Otog	UTSW	7	46300044	missense	probably damaging	1.00
R2407:Otog	UTSW	7	46241540	missense	probably benign	0.10
R2424:Otog	UTSW	7	46298169	nonsense	probably null
R2513:Otog	UTSW	7	46305590	critical splice donor site	probably null
R2863:Otog	UTSW	7	46269306	missense	probably damaging	1.00
R3148:Otog	UTSW	7	46290169	missense	probably damaging	1.00
R3732:Otog	UTSW	7	46288368	missense	probably benign	0.03
R3732:Otog	UTSW	7	46288368	missense	probably benign	0.03
R3733:Otog	UTSW	7	46288368	missense	probably benign	0.03
R3734:Otog	UTSW	7	46288368	missense	probably benign	0.03
R3855:Otog	UTSW	7	46273760	missense	possibly damaging	0.65
R3880:Otog	UTSW	7	46288021	missense	possibly damaging	0.93
R4081:Otog	UTSW	7	46288299	missense	possibly damaging	0.92
R4349:Otog	UTSW	7	46274189	missense	probably damaging	0.99
R4382:Otog	UTSW	7	46289698	missense	probably damaging	1.00
R4392:Otog	UTSW	7	46285124	missense	probably damaging	0.98
R4520:Otog	UTSW	7	46241053	unclassified	probably benign
R4569:Otog	UTSW	7	46310147	missense	probably damaging	1.00
R4580:Otog	UTSW	7	46287801	missense	possibly damaging	0.78
R4672:Otog	UTSW	7	46289786	missense	probably damaging	0.98
R4764:Otog	UTSW	7	46288519	missense	probably benign	0.29
R4910:Otog	UTSW	7	46264062	missense	probably damaging	1.00
R4910:Otog	UTSW	7	46298534	missense	probably damaging	1.00
R4913:Otog	UTSW	7	46264102	missense	probably benign	0.31
R4975:Otog	UTSW	7	46287991	missense	probably benign	0.00
R4996:Otog	UTSW	7	46298606	missense	possibly damaging	0.51
R4996:Otog	UTSW	7	46305510	nonsense	probably null
R5116:Otog	UTSW	7	46273767	missense	probably benign	0.34
R5138:Otog	UTSW	7	46250006	missense	possibly damaging	0.61
R5169:Otog	UTSW	7	46298148	missense	probably benign	0.06
R5239:Otog	UTSW	7	46287435	missense	probably benign	0.15
R5277:Otog	UTSW	7	46246621	missense	possibly damaging	0.89
R5287:Otog	UTSW	7	46269329	missense	probably damaging	0.98
R5299:Otog	UTSW	7	46288851	missense	probably benign	0.16
R5378:Otog	UTSW	7	46255004	missense	probably damaging	1.00
R5382:Otog	UTSW	7	46249004	missense	probably damaging	1.00
R5487:Otog	UTSW	7	46288768	missense	probably benign	0.27
R5507:Otog	UTSW	7	46261699	missense	probably damaging	1.00
R5517:Otog	UTSW	7	46274571	missense	probably damaging	1.00
R5643:Otog	UTSW	7	46287447	missense	probably damaging	1.00
R5757:Otog	UTSW	7	46241121	critical splice donor site	probably null
R5910:Otog	UTSW	7	46298598	missense	possibly damaging	0.94
R6019:Otog	UTSW	7	46288950	missense	probably benign	0.00
R6150:Otog	UTSW	7	46264059	missense	possibly damaging	0.82
R6225:Otog	UTSW	7	46249034	missense	possibly damaging	0.67
R6271:Otog	UTSW	7	46252040	missense	probably damaging	1.00
R6317:Otog	UTSW	7	46301215	missense	probably damaging	1.00
R6454:Otog	UTSW	7	46305817	missense	probably damaging	1.00
R6640:Otog	UTSW	7	46261743	missense	possibly damaging	0.92
R6753:Otog	UTSW	7	46249071	missense	probably benign	0.06
R6788:Otog	UTSW	7	46298317	missense	probably damaging	1.00
R6859:Otog	UTSW	7	46273781	missense	probably damaging	0.96
R7033:Otog	UTSW	7	46267398	critical splice donor site	probably null
R7071:Otog	UTSW	7	46267323	missense	probably damaging	1.00
R7084:Otog	UTSW	7	46298566	nonsense	probably null
R7116:Otog	UTSW	7	46298265	missense	probably damaging	0.99
R7202:Otog	UTSW	7	46288050	missense	probably damaging	0.97
R7365:Otog	UTSW	7	46298308	missense	probably damaging	1.00
R7468:Otog	UTSW	7	46264119	missense	probably benign
R7475:Otog	UTSW	7	46267276	missense	probably damaging	0.99
R7502:Otog	UTSW	7	46298615	missense	probably damaging	1.00
R7558:Otog	UTSW	7	46303160	missense	probably damaging	0.99
R7577:Otog	UTSW	7	46287855	missense	possibly damaging	0.62
R7651:Otog	UTSW	7	46241761	missense	probably benign	0.00
R7689:Otog	UTSW	7	46252056	missense	probably damaging	1.00
R7806:Otog	UTSW	7	46285776	missense	probably benign
R7933:Otog	UTSW	7	46310147	missense	probably damaging	1.00
R8021:Otog	UTSW	7	46267342	missense	probably damaging	0.98
R8082:Otog	UTSW	7	46289719	missense	probably damaging	1.00
R8531:Otog	UTSW	7	46252049	missense	probably damaging	0.99
R8772:Otog	UTSW	7	46284928	missense	probably damaging	1.00
R8816:Otog	UTSW	7	46301481	missense	possibly damaging	0.92
R8842:Otog	UTSW	7	46246524	missense	probably damaging	1.00
R8987:Otog	UTSW	7	46287454	missense	probably benign	0.43
R8988:Otog	UTSW	7	46310147	missense	probably damaging	1.00
R9010:Otog	UTSW	7	46300470	missense	probably benign	0.00
R9025:Otog	UTSW	7	46288096	missense	probably benign	0.13
R9131:Otog	UTSW	7	46303173	nonsense	probably null
R9179:Otog	UTSW	7	46288461	missense	possibly damaging	0.65
R9334:Otog	UTSW	7	46259929	missense	possibly damaging	0.95
R9365:Otog	UTSW	7	46271264	missense	probably damaging	1.00
R9408:Otog	UTSW	7	46267297	missense	possibly damaging	0.79
R9418:Otog	UTSW	7	46288600	missense	probably benign	0.41
R9465:Otog	UTSW	7	46305875	missense	possibly damaging	0.80
R9496:Otog	UTSW	7	46241081	missense	unknown
R9632:Otog	UTSW	7	46265719	missense	probably benign	0.27
R9656:Otog	UTSW	7	46310143	missense	probably damaging	1.00
RF024:Otog	UTSW	7	46287669	missense	probably damaging	1.00
X0062:Otog	UTSW	7	46259921	missense	probably damaging	1.00
Z1177:Otog	UTSW	7	46262852	missense	possibly damaging	0.80
Z1177:Otog	UTSW	7	46274538	missense	probably damaging	1.00
Z1177:Otog	UTSW	7	46289740	missense	probably damaging	1.00
Z1177:Otog	UTSW	7	46309985	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCCCATCAGAAAAGGGACTG -3'
(R):5'- CAGGACAAAGTGAGCCTAGATC -3'

Sequencing Primer
(F):5'- CATCAGAAAAGGGACTGTGTTGTGTC -3'
(R):5'- AGCCTAGATCTGTATGGGCAC -3'

Posted On

2014-06-23