Mutagenetix > Incidental Mutation

Incidental Mutation 'R0115:Bdp1'

20743

Institutional Source

Beutler Lab

Gene Symbol

Bdp1

Ensembl Gene

ENSMUSG00000049658

Gene Name

B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB

Synonyms

TAF3B1, TFC5, Tfnr, B130055N23Rik, TFIIIB90, TFIIIB150, G630013P12Rik

MMRRC Submission

038401-MU

Accession Numbers

Genbank: NM_001081061; MGI: 1347077

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0115 (G1)

Quality Score

180

Status

Validated (trace)

Chromosome

Chromosomal Location

100017994-100104070 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 100041454 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 1969 (I1969T)

Ref Sequence

ENSEMBL: ENSMUSP00000105005 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038104] [ENSMUST00000109379]

AlphaFold

Q571C7

Predicted Effect

probably benign
Transcript: ENSMUST00000038104
AA Change: I1969T

PolyPhen 2 Score 0.278 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000038321
Gene: ENSMUSG00000049658
AA Change: I1969T

Domain	Start	End	E-Value	Type
low complexity region	25	45	N/A	INTRINSIC
low complexity region	81	92	N/A	INTRINSIC
low complexity region	147	164	N/A	INTRINSIC
low complexity region	231	242	N/A	INTRINSIC
SANT	301	349	1.52e-4	SMART
coiled coil region	375	399	N/A	INTRINSIC
coiled coil region	457	487	N/A	INTRINSIC
internal_repeat_1	593	895	3.56e-18	PROSPERO
coiled coil region	1013	1038	N/A	INTRINSIC
internal_repeat_1	1253	1612	3.56e-18	PROSPERO
low complexity region	1718	1733	N/A	INTRINSIC
low complexity region	1763	1774	N/A	INTRINSIC
low complexity region	1912	1921	N/A	INTRINSIC
low complexity region	2185	2199	N/A	INTRINSIC
low complexity region	2335	2346	N/A	INTRINSIC
low complexity region	2398	2412	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000099262

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000105697

Predicted Effect

probably benign
Transcript: ENSMUST00000109379
AA Change: I1969T

PolyPhen 2 Score 0.278 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000105005
Gene: ENSMUSG00000049658
AA Change: I1969T

Domain	Start	End	E-Value	Type
low complexity region	25	45	N/A	INTRINSIC
low complexity region	81	92	N/A	INTRINSIC
low complexity region	147	164	N/A	INTRINSIC
low complexity region	231	242	N/A	INTRINSIC
SANT	301	349	1.52e-4	SMART
coiled coil region	457	487	N/A	INTRINSIC
internal_repeat_1	593	895	4.79e-19	PROSPERO
coiled coil region	1013	1038	N/A	INTRINSIC
internal_repeat_1	1253	1612	4.79e-19	PROSPERO
low complexity region	1718	1733	N/A	INTRINSIC
low complexity region	1763	1774	N/A	INTRINSIC
low complexity region	1912	1921	N/A	INTRINSIC
low complexity region	2185	2199	N/A	INTRINSIC
low complexity region	2335	2346	N/A	INTRINSIC
low complexity region	2398	2412	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 94.2%
20x: 86.0%

Validation Efficiency

98% (98/100)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a subunit of the TFIIIB transcription initiation complex, which recruits RNA polymerase III to target promoters in order to initiate transcription. The encoded protein localizes to concentrated aggregates in the nucleus, and is required for transcription from all three types of polymerase III promoters. It is phosphorylated by casein kinase II during mitosis, resulting in its release from chromatin and suppression of polymerase III transcription. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011I03Rik	G	A	18: 57,594,142		probably benign	Het
2310007B03Rik	A	T	1: 93,159,725	S135R	possibly damaging	Het
4921528I07Rik	A	G	9: 114,279,384		noncoding transcript	Het
Alas1	A	T	9: 106,238,252		probably null	Het
Arf5	A	G	6: 28,426,076	Y154C	probably damaging	Het
Arhgap20	T	A	9: 51,838,972	I344N	probably damaging	Het
Arhgap30	A	C	1: 171,407,948	E630A	possibly damaging	Het
B4galt5	A	G	2: 167,309,234	L118P	probably damaging	Het
Bysl	C	T	17: 47,610,942	R77Q	probably benign	Het
Cap1	A	T	4: 122,863,075	H272Q	possibly damaging	Het
Ccdc146	T	C	5: 21,322,756	I187M	possibly damaging	Het
Cdk13	C	A	13: 17,719,494	A1123S	probably damaging	Het
Ces5a	A	T	8: 93,502,183	M473K	probably damaging	Het
Chd8	A	G	14: 52,237,206	S123P	probably benign	Het
Cwc22	G	A	2: 77,908,111	A497V	probably damaging	Het
Cwh43	T	C	5: 73,418,027	S296P	probably damaging	Het
Cyp2c50	T	A	19: 40,092,393		probably benign	Het
Dlg1	C	A	16: 31,805,690	Y399*	probably null	Het
Drosha	A	T	15: 12,846,130	E92D	probably benign	Het
Fanca	C	T	8: 123,268,539	G1408D	probably benign	Het
Frem1	T	A	4: 82,936,169	D1621V	possibly damaging	Het
Frem2	G	A	3: 53,656,208	R293C	probably damaging	Het
Fut8	T	A	12: 77,448,560	V308D	probably damaging	Het
Glipr1	A	G	10: 111,993,541	I105T	probably benign	Het
Glmn	A	T	5: 107,560,934	S385T	probably benign	Het
Gm281	A	G	14: 13,899,571	V117A	probably damaging	Het
Gon4l	T	A	3: 88,895,682	V1200D	probably damaging	Het
Gpc1	G	A	1: 92,857,499	D387N	probably damaging	Het
Gsdmc	A	G	15: 63,803,637	Y110H	probably damaging	Het
Gucy1b1	T	A	3: 82,034,391	H586L	probably benign	Het
Gucy2e	A	G	11: 69,236,632	L5P	unknown	Het
Hectd4	A	G	5: 121,295,506		probably benign	Het
Hmcn1	T	A	1: 150,808,647	I391F	possibly damaging	Het
Hsf4	A	T	8: 105,272,704		probably null	Het
I830077J02Rik	G	A	3: 105,926,570	T90M	probably damaging	Het
Ino80	A	T	2: 119,431,016	H722Q	probably damaging	Het
Kcnma1	C	A	14: 23,314,175	R980L	probably damaging	Het
Kif1a	A	G	1: 93,046,778		probably benign	Het
Klhdc7b	A	G	15: 89,388,521	H1202R	probably benign	Het
Lig3	A	G	11: 82,793,935	D559G	probably damaging	Het
Lyst	T	C	13: 13,677,952	V2179A	probably benign	Het
Mansc4	A	G	6: 147,075,227	I297T	possibly damaging	Het
March6	A	T	15: 31,475,812	F633I	probably benign	Het
Marf1	C	T	16: 14,142,534	A549T	probably damaging	Het
Megf10	G	T	18: 57,259,802	V424L	possibly damaging	Het
Mfsd13a	C	T	19: 46,366,504	T40I	probably benign	Het
Mib2	A	G	4: 155,656,062		probably benign	Het
Mut	C	T	17: 40,956,227	T564M	probably damaging	Het
Myh8	A	G	11: 67,306,264		probably benign	Het
Mypn	T	C	10: 63,192,380		probably benign	Het
Nf1	G	A	11: 79,468,876		probably null	Het
Notch3	T	A	17: 32,133,462	T1866S	possibly damaging	Het
Olfr108	C	T	17: 37,445,779	A86V	probably benign	Het
Olfr1189	A	T	2: 88,592,655	I284F	probably damaging	Het
Olfr1301	T	A	2: 111,754,585	M112K	probably damaging	Het
Olfr390	A	G	11: 73,787,315	I126V	possibly damaging	Het
Pkhd1	A	T	1: 20,350,490	I2464N	probably damaging	Het
Pkn1	A	G	8: 83,671,029	S817P	probably damaging	Het
Prkg2	A	T	5: 98,994,655		probably null	Het
Prl8a6	T	C	13: 27,433,101	D201G	probably benign	Het
Psmd1	C	T	1: 86,083,271	T356I	possibly damaging	Het
Ptk6	G	A	2: 181,202,527		probably benign	Het
Ptprn2	T	C	12: 117,211,846		probably benign	Het
Rbm42	G	A	7: 30,647,775	T106I	probably damaging	Het
Rims4	A	T	2: 163,864,120	V198E	probably damaging	Het
Ripk1	T	C	13: 34,009,750	S32P	probably damaging	Het
Rorc	T	C	3: 94,377,609		probably benign	Het
Rpl22l1	T	C	3: 28,806,536	F15L	probably damaging	Het
Slc6a20a	C	A	9: 123,678,758	A17S	possibly damaging	Het
Sorcs1	A	G	19: 50,636,453		probably benign	Het
Sp100	A	G	1: 85,650,131		probably benign	Het
Ssc5d	G	A	7: 4,927,881		probably benign	Het
Taf11	A	G	17: 27,907,661	L4P	probably benign	Het
Tm2d3	A	G	7: 65,695,334		probably benign	Het
Tmub2	T	C	11: 102,288,375		probably null	Het
Trim34a	T	A	7: 104,247,902	C58S	probably damaging	Het
Trpc3	T	C	3: 36,624,417	I840V	probably benign	Het
Trpm6	T	C	19: 18,829,952	V1020A	probably damaging	Het
Vmn1r214	T	A	13: 23,035,294	Y319*	probably null	Het
Vmn1r59	T	C	7: 5,454,116	N215S	probably benign	Het
Vmn2r74	T	C	7: 85,957,356	M261V	probably benign	Het
Vmn2r89	T	C	14: 51,456,120	F309S	probably damaging	Het
Wdr95	A	T	5: 149,564,390	D163V	probably damaging	Het
Xirp2	T	A	2: 67,509,909	F831L	possibly damaging	Het
Ythdc2	C	T	18: 44,841,423		probably benign	Het

Other mutations in Bdp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Bdp1	APN	13	100098510	missense	probably damaging	1.00
IGL00096:Bdp1	APN	13	100060865	missense	possibly damaging	0.61
IGL00160:Bdp1	APN	13	100061198	missense	probably benign	0.00
IGL00924:Bdp1	APN	13	100097579	missense	possibly damaging	0.89
IGL01337:Bdp1	APN	13	100056192	missense	probably benign	0.00
IGL01344:Bdp1	APN	13	100078080	missense	probably benign	0.06
IGL01347:Bdp1	APN	13	100070203	missense	possibly damaging	0.79
IGL01620:Bdp1	APN	13	100084205	splice site	probably benign
IGL01871:Bdp1	APN	13	100066053	missense	probably benign	0.01
IGL02008:Bdp1	APN	13	100023827	missense	possibly damaging	0.92
IGL02112:Bdp1	APN	13	100037800	missense	probably benign	0.02
IGL02214:Bdp1	APN	13	100041535	missense	probably benign	0.00
IGL02236:Bdp1	APN	13	100060891	missense	probably benign
IGL02307:Bdp1	APN	13	100093438	missense	probably damaging	1.00
IGL02364:Bdp1	APN	13	100055308	splice site	probably benign
IGL02415:Bdp1	APN	13	100089408	missense	probably damaging	0.96
IGL02601:Bdp1	APN	13	100098514	missense	possibly damaging	0.72
IGL02605:Bdp1	APN	13	100078115	critical splice acceptor site	probably null
IGL02664:Bdp1	APN	13	100051539	missense	probably benign	0.29
IGL02738:Bdp1	APN	13	100051353	missense	probably benign	0.26
IGL02754:Bdp1	APN	13	100060973	missense	possibly damaging	0.94
IGL02967:Bdp1	APN	13	100042270	missense	possibly damaging	0.92
IGL02974:Bdp1	APN	13	100055292	missense	probably benign	0.00
IGL03156:Bdp1	APN	13	100061036	missense	probably benign	0.44
IGL03166:Bdp1	APN	13	100035800	missense	probably benign	0.28
IGL03232:Bdp1	APN	13	100051481	missense	probably damaging	1.00
D3080:Bdp1	UTSW	13	100023621	missense	probably benign	0.02
R0481:Bdp1	UTSW	13	100041454	missense	probably benign	0.28
R0619:Bdp1	UTSW	13	100037858	missense	probably benign	0.00
R0730:Bdp1	UTSW	13	100058951	splice site	probably benign
R0744:Bdp1	UTSW	13	100035825	missense	probably benign	0.01
R0833:Bdp1	UTSW	13	100035825	missense	probably benign	0.01
R1307:Bdp1	UTSW	13	100049763	missense	possibly damaging	0.89
R1325:Bdp1	UTSW	13	100099008	missense	probably damaging	0.97
R1346:Bdp1	UTSW	13	100078755	nonsense	probably null
R1644:Bdp1	UTSW	13	100060940	missense	probably benign	0.03
R1670:Bdp1	UTSW	13	100027433	critical splice donor site	probably null
R1836:Bdp1	UTSW	13	100035145	missense	probably benign
R1869:Bdp1	UTSW	13	100042201	missense	probably damaging	0.99
R1920:Bdp1	UTSW	13	100098589	missense	probably benign	0.30
R1944:Bdp1	UTSW	13	100074381	splice site	probably null
R2030:Bdp1	UTSW	13	100061189	missense	probably benign	0.00
R2069:Bdp1	UTSW	13	100050988	missense	probably benign	0.00
R2180:Bdp1	UTSW	13	100061405	small insertion	probably benign
R2263:Bdp1	UTSW	13	100066037	missense	probably damaging	0.96
R2277:Bdp1	UTSW	13	100061330	missense	probably benign	0.05
R2277:Bdp1	UTSW	13	100061339	missense	probably damaging	1.00
R2278:Bdp1	UTSW	13	100061330	missense	probably benign	0.05
R2278:Bdp1	UTSW	13	100061339	missense	probably damaging	1.00
R2336:Bdp1	UTSW	13	100053002	missense	probably damaging	0.99
R2380:Bdp1	UTSW	13	100060370	missense	probably benign	0.08
R3154:Bdp1	UTSW	13	100049814	missense	probably damaging	1.00
R4212:Bdp1	UTSW	13	100059585	missense	probably benign
R4322:Bdp1	UTSW	13	100092223	missense	probably damaging	0.97
R4414:Bdp1	UTSW	13	100030861	missense	probably damaging	0.99
R4415:Bdp1	UTSW	13	100030861	missense	probably damaging	0.99
R4764:Bdp1	UTSW	13	100056267	missense	probably damaging	0.99
R4766:Bdp1	UTSW	13	100049868	missense	probably damaging	0.96
R4888:Bdp1	UTSW	13	100051119	missense	probably benign	0.26
R4914:Bdp1	UTSW	13	100056336	missense	probably benign	0.28
R4917:Bdp1	UTSW	13	100055205	missense	probably damaging	0.99
R4918:Bdp1	UTSW	13	100055205	missense	probably damaging	0.99
R5170:Bdp1	UTSW	13	100030794	nonsense	probably null
R5266:Bdp1	UTSW	13	100067535	missense	probably benign	0.33
R5312:Bdp1	UTSW	13	100097601	splice site	probably null
R5420:Bdp1	UTSW	13	100066043	missense	possibly damaging	0.88
R5486:Bdp1	UTSW	13	100098510	missense	probably damaging	1.00
R5909:Bdp1	UTSW	13	100092286	missense	probably benign	0.08
R5913:Bdp1	UTSW	13	100051104	missense	probably benign	0.41
R6018:Bdp1	UTSW	13	100038224	missense	probably benign	0.00
R6037:Bdp1	UTSW	13	100027449	missense	possibly damaging	0.65
R6037:Bdp1	UTSW	13	100027449	missense	possibly damaging	0.65
R6700:Bdp1	UTSW	13	100025528	missense	probably benign	0.00
R6969:Bdp1	UTSW	13	100074531	missense	probably damaging	0.97
R6972:Bdp1	UTSW	13	100037761	missense	probably null	1.00
R6996:Bdp1	UTSW	13	100043813	missense	probably damaging	1.00
R7043:Bdp1	UTSW	13	100078707	missense	probably benign	0.03
R7060:Bdp1	UTSW	13	100059494	missense	probably damaging	1.00
R7105:Bdp1	UTSW	13	100070181	missense	probably damaging	1.00
R7155:Bdp1	UTSW	13	100061151	missense	possibly damaging	0.93
R7175:Bdp1	UTSW	13	100049970	missense	probably damaging	0.97
R7177:Bdp1	UTSW	13	100049970	missense	probably damaging	0.97
R7327:Bdp1	UTSW	13	100041532	missense	probably damaging	0.97
R7512:Bdp1	UTSW	13	100050949	missense	probably benign	0.03
R7562:Bdp1	UTSW	13	100025541	missense	probably benign	0.04
R7583:Bdp1	UTSW	13	100049812	missense	probably damaging	1.00
R7788:Bdp1	UTSW	13	100055251	missense	possibly damaging	0.64
R7842:Bdp1	UTSW	13	100099129	missense	probably damaging	1.00
R7850:Bdp1	UTSW	13	100092324	missense	probably damaging	1.00
R7904:Bdp1	UTSW	13	100041436	missense	probably benign	0.37
R7975:Bdp1	UTSW	13	100020376	missense	probably benign	0.01
R7999:Bdp1	UTSW	13	100058896	missense	possibly damaging	0.93
R8126:Bdp1	UTSW	13	100056282	missense	probably damaging	1.00
R8340:Bdp1	UTSW	13	100065968	missense	possibly damaging	0.61
R8414:Bdp1	UTSW	13	100064477	missense	probably benign	0.03
R8468:Bdp1	UTSW	13	100060568	missense	probably benign	0.04
R8688:Bdp1	UTSW	13	100103799	missense	probably damaging	1.00
R8871:Bdp1	UTSW	13	100049667	missense	probably damaging	1.00
R8976:Bdp1	UTSW	13	100060899	nonsense	probably null
R8987:Bdp1	UTSW	13	100067513	missense	probably benign	0.01
R9157:Bdp1	UTSW	13	100049928	missense	probably benign	0.40
R9437:Bdp1	UTSW	13	100025650	missense	probably benign	0.31
R9612:Bdp1	UTSW	13	100077862	missense	probably benign	0.18
R9679:Bdp1	UTSW	13	100043777	missense	probably damaging	0.98
RF003:Bdp1	UTSW	13	100060449	missense	probably benign	0.31
RF003:Bdp1	UTSW	13	100060450	missense	probably benign	0.31
Z1177:Bdp1	UTSW	13	100061396	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACCTCCAGAGTGCTGTGAATCAGG -3'
(R):5'- AGACAGACACAGGGACTCTCATGAC -3'

Sequencing Primer
(F):5'- gcagtcagttctctcttctacc -3'
(R):5'- ACAGGGACTCTCATGACTTTAC -3'

Posted On

2013-04-11