Incidental Mutation 'R1843:Tex15'
ID 207435
Institutional Source Beutler Lab
Gene Symbol Tex15
Ensembl Gene ENSMUSG00000009628
Gene Name testis expressed gene 15
Synonyms 2210014E14Rik
MMRRC Submission 039868-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.292) question?
Stock # R1843 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 34006766-34075610 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 34066682 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 2037 (D2037E)
Ref Sequence ENSEMBL: ENSMUSP00000009772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009772] [ENSMUST00000124496] [ENSMUST00000124501]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000009772
AA Change: D2037E

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000009772
Gene: ENSMUSG00000009628
AA Change: D2037E

DomainStartEndE-ValueType
low complexity region 262 274 N/A INTRINSIC
low complexity region 302 313 N/A INTRINSIC
low complexity region 524 536 N/A INTRINSIC
low complexity region 665 674 N/A INTRINSIC
low complexity region 713 725 N/A INTRINSIC
low complexity region 946 961 N/A INTRINSIC
low complexity region 1497 1508 N/A INTRINSIC
Pfam:TEX15 1572 1788 1.3e-109 PFAM
Pfam:TEX15 1901 2119 1.1e-16 PFAM
low complexity region 2758 2770 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124496
SMART Domains Protein: ENSMUSP00000120744
Gene: ENSMUSG00000009628

DomainStartEndE-ValueType
Pfam:DUF3715 89 251 1.6e-58 PFAM
low complexity region 536 548 N/A INTRINSIC
low complexity region 576 587 N/A INTRINSIC
low complexity region 798 810 N/A INTRINSIC
low complexity region 939 948 N/A INTRINSIC
low complexity region 987 999 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124501
SMART Domains Protein: ENSMUSP00000138070
Gene: ENSMUSG00000009628

DomainStartEndE-ValueType
Pfam:DUF3715 96 251 2.4e-52 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male mice are infertile due to arrest of meiosis stemming from failure to repair double-strand breaks. However, female mice are fertile. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik C T 8: 106,435,606 (GRCm39) T88M probably damaging Het
9430038I01Rik A G 7: 136,978,795 (GRCm39) probably benign Het
Adgra3 A C 5: 50,118,834 (GRCm39) S905A probably damaging Het
Adgrv1 A G 13: 81,692,652 (GRCm39) Y1618H probably damaging Het
Anapc15-ps T C 10: 95,509,176 (GRCm39) T26A probably benign Het
Ankrd13d T C 19: 4,321,623 (GRCm39) K360E probably damaging Het
Anks1b T A 10: 90,348,751 (GRCm39) probably null Het
Apob T C 12: 8,057,602 (GRCm39) F2028S possibly damaging Het
Arap3 G A 18: 38,108,636 (GRCm39) R1265W probably damaging Het
Arhgef37 A G 18: 61,651,121 (GRCm39) Y135H probably damaging Het
Armh3 A C 19: 45,963,691 (GRCm39) S42R probably benign Het
Atp1a1 T C 3: 101,489,333 (GRCm39) T760A probably benign Het
Cdc42bpb T A 12: 111,289,255 (GRCm39) M497L probably benign Het
Ces5a C T 8: 94,240,859 (GRCm39) V413M probably damaging Het
Chd5 A T 4: 152,470,263 (GRCm39) Y1903F probably damaging Het
Chd9 T A 8: 91,737,422 (GRCm39) N1500K probably benign Het
Chmp7 G T 14: 69,957,248 (GRCm39) D303E probably benign Het
Chrnb4 A T 9: 54,942,102 (GRCm39) Y391N possibly damaging Het
Crtc1 T C 8: 70,840,802 (GRCm39) T475A probably benign Het
Cyp2c69 A G 19: 39,865,972 (GRCm39) I207T probably benign Het
Dcp1a A G 14: 30,240,940 (GRCm39) E250G probably damaging Het
Ddx20 T C 3: 105,586,398 (GRCm39) Q649R probably benign Het
Defb12 T A 8: 19,162,754 (GRCm39) K59N probably damaging Het
Dpy19l3 A T 7: 35,429,185 (GRCm39) I85N probably damaging Het
Duox2 C T 2: 122,122,739 (GRCm39) probably null Het
Ebi3 T A 17: 56,263,679 (GRCm39) Y197N probably damaging Het
Emc1 G A 4: 139,102,823 (GRCm39) R994Q probably benign Het
Ercc6 G T 14: 32,268,777 (GRCm39) M530I probably damaging Het
Evl T A 12: 108,619,255 (GRCm39) D70E probably damaging Het
Fbln2 A G 6: 91,242,757 (GRCm39) N819S probably damaging Het
Foxk2 A G 11: 121,176,363 (GRCm39) I170V probably benign Het
Gfm1 T C 3: 67,342,943 (GRCm39) V159A probably damaging Het
Gm10837 A G 14: 122,728,177 (GRCm39) T18A unknown Het
Gm12887 A T 4: 121,479,227 (GRCm39) V25E probably damaging Het
Hectd4 A G 5: 121,435,243 (GRCm39) H985R possibly damaging Het
Hsfy2 A G 1: 56,675,791 (GRCm39) Y249H possibly damaging Het
Hspg2 T C 4: 137,272,878 (GRCm39) V2639A probably damaging Het
Igf2r A G 17: 12,923,157 (GRCm39) probably null Het
Invs T A 4: 48,422,035 (GRCm39) I889N probably damaging Het
Kcnq1 A T 7: 142,736,857 (GRCm39) M209L probably benign Het
Klra7 A G 6: 130,206,957 (GRCm39) I48T possibly damaging Het
Krt26 CTAGTA CTA 11: 99,224,352 (GRCm39) probably benign Het
Lrif1 T A 3: 106,640,127 (GRCm39) V404D probably damaging Het
Lrriq1 T A 10: 103,063,034 (GRCm39) probably null Het
Lypd6 T A 2: 50,078,774 (GRCm39) I90N possibly damaging Het
Mbp A G 18: 82,602,247 (GRCm39) D174G probably damaging Het
Megf9 G T 4: 70,453,022 (GRCm39) P13Q probably damaging Het
Myo15b A T 11: 115,760,412 (GRCm39) T1155S probably benign Het
Nherf2 C T 17: 24,860,693 (GRCm39) S150N possibly damaging Het
Nlrp6 T A 7: 140,503,006 (GRCm39) C371S probably damaging Het
Nosip T A 7: 44,726,733 (GRCm39) probably null Het
Nox3 G T 17: 3,720,153 (GRCm39) P344H probably damaging Het
Nup210l T C 3: 90,079,393 (GRCm39) V959A probably damaging Het
Or10d1 A G 9: 39,484,031 (GRCm39) Y175H possibly damaging Het
Or2b2b C A 13: 21,858,842 (GRCm39) V91L probably benign Het
Or2k2 T C 4: 58,785,384 (GRCm39) I113V probably benign Het
Or5b119 A G 19: 13,457,295 (GRCm39) I89T probably benign Het
Or5k8 T A 16: 58,644,440 (GRCm39) I211F probably damaging Het
Osbpl3 A C 6: 50,347,123 (GRCm39) S25A probably damaging Het
Otog G A 7: 45,895,707 (GRCm39) C107Y probably damaging Het
Pax7 G A 4: 139,511,802 (GRCm39) R260C probably damaging Het
Pbrm1 A T 14: 30,760,914 (GRCm39) I224F probably damaging Het
Pcdh1 T A 18: 38,325,278 (GRCm39) probably null Het
Pcnx1 T C 12: 82,027,709 (GRCm39) L1585P probably damaging Het
Pde4c C T 8: 71,200,599 (GRCm39) H362Y probably damaging Het
Pdlim2 C T 14: 70,402,228 (GRCm39) R296H probably damaging Het
Pgm1 A T 4: 99,818,675 (GRCm39) Q90L probably damaging Het
Phlpp1 A G 1: 106,271,235 (GRCm39) H814R probably benign Het
Pknox2 A T 9: 36,866,127 (GRCm39) M5K possibly damaging Het
Pole G A 5: 110,478,701 (GRCm39) probably null Het
Polr1b A G 2: 128,944,886 (GRCm39) I61V probably benign Het
Prelp T C 1: 133,842,495 (GRCm39) K217E probably damaging Het
Prkce C T 17: 86,782,974 (GRCm39) Q202* probably null Het
Psmd2 T G 16: 20,475,332 (GRCm39) M370R probably benign Het
Rimklb A T 6: 122,440,968 (GRCm39) H68Q probably damaging Het
Rnasel A G 1: 153,630,420 (GRCm39) D312G possibly damaging Het
Rxrg A T 1: 167,426,321 (GRCm39) M1L probably benign Het
Scrn1 A G 6: 54,499,826 (GRCm39) F220L possibly damaging Het
Scyl3 A G 1: 163,778,244 (GRCm39) S461G probably benign Het
Serpina1c T A 12: 103,861,282 (GRCm39) T411S probably benign Het
Serpinb6d C T 13: 33,855,364 (GRCm39) P346L probably benign Het
Shld2 A G 14: 33,989,760 (GRCm39) I382T probably benign Het
Spg21 G T 9: 65,372,618 (GRCm39) V17F probably damaging Het
Spink5 A T 18: 44,132,958 (GRCm39) M525L probably benign Het
Sun2 T C 15: 79,621,764 (GRCm39) T155A probably benign Het
Tchh T A 3: 93,354,087 (GRCm39) F1176I unknown Het
Tfdp2 T C 9: 96,199,857 (GRCm39) C392R possibly damaging Het
Tmem30c T C 16: 57,097,143 (GRCm39) N139S probably benign Het
Tns2 C T 15: 102,021,568 (GRCm39) probably null Het
Trim66 T C 7: 109,075,046 (GRCm39) E405G probably damaging Het
Trpc4 T A 3: 54,187,415 (GRCm39) F456I probably benign Het
Tspo2 T C 17: 48,755,818 (GRCm39) D108G possibly damaging Het
Tyk2 A T 9: 21,032,850 (GRCm39) C304* probably null Het
Vgll4 A T 6: 114,839,756 (GRCm39) S185T probably benign Het
Vmn2r94 A C 17: 18,464,732 (GRCm39) S519R probably benign Het
Vmn2r96 T G 17: 18,818,183 (GRCm39) S587A probably benign Het
Vps4b C A 1: 106,706,712 (GRCm39) A287S possibly damaging Het
Yeats2 C T 16: 20,048,314 (GRCm39) P1332S probably benign Het
Zfp462 T G 4: 55,010,010 (GRCm39) S659A possibly damaging Het
Zfp507 C T 7: 35,493,150 (GRCm39) R631Q probably damaging Het
Zfp764l1 A C 7: 126,990,660 (GRCm39) D442E probably benign Het
Zswim5 G T 4: 116,734,896 (GRCm39) E80D unknown Het
Other mutations in Tex15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Tex15 APN 8 34,065,339 (GRCm39) missense probably benign 0.18
IGL00705:Tex15 APN 8 34,071,620 (GRCm39) missense probably damaging 1.00
IGL00820:Tex15 APN 8 34,069,034 (GRCm39) splice site probably benign
IGL01288:Tex15 APN 8 34,061,412 (GRCm39) missense probably benign 0.02
IGL01328:Tex15 APN 8 34,061,424 (GRCm39) nonsense probably null
IGL01359:Tex15 APN 8 34,071,926 (GRCm39) missense probably damaging 0.99
IGL01603:Tex15 APN 8 34,063,575 (GRCm39) missense possibly damaging 0.93
IGL01861:Tex15 APN 8 34,060,717 (GRCm39) missense probably damaging 1.00
IGL02052:Tex15 APN 8 34,072,493 (GRCm39) missense probably benign 0.28
IGL02560:Tex15 APN 8 34,071,779 (GRCm39) missense probably benign 0.00
IGL02677:Tex15 APN 8 34,061,108 (GRCm39) missense probably benign 0.03
IGL02739:Tex15 APN 8 34,071,721 (GRCm39) missense possibly damaging 0.68
Big_gulp UTSW 8 34,071,762 (GRCm39) missense probably damaging 1.00
P0005:Tex15 UTSW 8 34,060,896 (GRCm39) missense probably benign 0.00
P0037:Tex15 UTSW 8 34,071,608 (GRCm39) missense probably benign 0.00
PIT4377001:Tex15 UTSW 8 34,061,129 (GRCm39) missense probably damaging 1.00
R0056:Tex15 UTSW 8 34,072,055 (GRCm39) missense probably benign 0.00
R0056:Tex15 UTSW 8 34,072,055 (GRCm39) missense probably benign 0.00
R0058:Tex15 UTSW 8 34,071,530 (GRCm39) splice site probably benign
R0058:Tex15 UTSW 8 34,071,530 (GRCm39) splice site probably benign
R0595:Tex15 UTSW 8 34,062,645 (GRCm39) missense probably damaging 1.00
R0646:Tex15 UTSW 8 34,072,354 (GRCm39) missense possibly damaging 0.83
R0688:Tex15 UTSW 8 34,063,528 (GRCm39) missense probably damaging 1.00
R0842:Tex15 UTSW 8 34,061,575 (GRCm39) missense possibly damaging 0.95
R0987:Tex15 UTSW 8 34,066,875 (GRCm39) missense probably damaging 1.00
R1084:Tex15 UTSW 8 34,067,032 (GRCm39) missense probably benign 0.28
R1183:Tex15 UTSW 8 34,064,893 (GRCm39) missense probably benign 0.35
R1186:Tex15 UTSW 8 34,061,661 (GRCm39) missense probably benign 0.19
R1378:Tex15 UTSW 8 34,065,244 (GRCm39) missense probably damaging 0.99
R1500:Tex15 UTSW 8 34,065,120 (GRCm39) missense probably damaging 0.96
R1508:Tex15 UTSW 8 34,066,880 (GRCm39) missense probably damaging 1.00
R1597:Tex15 UTSW 8 34,061,511 (GRCm39) missense probably damaging 0.96
R1636:Tex15 UTSW 8 34,066,415 (GRCm39) nonsense probably null
R1639:Tex15 UTSW 8 34,060,845 (GRCm39) missense possibly damaging 0.94
R1809:Tex15 UTSW 8 34,064,262 (GRCm39) missense probably benign
R2029:Tex15 UTSW 8 34,061,302 (GRCm39) missense probably damaging 0.99
R2228:Tex15 UTSW 8 34,061,265 (GRCm39) missense probably benign 0.05
R2229:Tex15 UTSW 8 34,061,265 (GRCm39) missense probably benign 0.05
R2245:Tex15 UTSW 8 34,061,524 (GRCm39) missense possibly damaging 0.77
R2246:Tex15 UTSW 8 34,072,540 (GRCm39) missense possibly damaging 0.49
R2880:Tex15 UTSW 8 34,064,935 (GRCm39) nonsense probably null
R2881:Tex15 UTSW 8 34,064,935 (GRCm39) nonsense probably null
R2882:Tex15 UTSW 8 34,064,935 (GRCm39) nonsense probably null
R3001:Tex15 UTSW 8 34,064,556 (GRCm39) missense probably benign 0.15
R3002:Tex15 UTSW 8 34,064,556 (GRCm39) missense probably benign 0.15
R3020:Tex15 UTSW 8 34,066,698 (GRCm39) missense probably damaging 1.00
R3084:Tex15 UTSW 8 34,064,913 (GRCm39) missense probably benign 0.11
R3085:Tex15 UTSW 8 34,064,913 (GRCm39) missense probably benign 0.11
R3701:Tex15 UTSW 8 34,064,194 (GRCm39) missense probably benign 0.00
R3702:Tex15 UTSW 8 34,064,194 (GRCm39) missense probably benign 0.00
R3752:Tex15 UTSW 8 34,061,443 (GRCm39) missense probably benign
R4162:Tex15 UTSW 8 34,071,586 (GRCm39) missense probably damaging 1.00
R4231:Tex15 UTSW 8 34,062,165 (GRCm39) missense probably damaging 0.99
R4589:Tex15 UTSW 8 34,047,401 (GRCm39) missense probably damaging 1.00
R4707:Tex15 UTSW 8 34,072,525 (GRCm39) missense probably benign 0.00
R4773:Tex15 UTSW 8 34,072,760 (GRCm39) missense probably benign 0.42
R4967:Tex15 UTSW 8 34,064,498 (GRCm39) missense probably benign 0.34
R5063:Tex15 UTSW 8 34,072,638 (GRCm39) missense possibly damaging 0.59
R5121:Tex15 UTSW 8 34,061,794 (GRCm39) missense probably damaging 1.00
R5147:Tex15 UTSW 8 34,062,340 (GRCm39) nonsense probably null
R5166:Tex15 UTSW 8 34,066,420 (GRCm39) missense probably benign 0.07
R5173:Tex15 UTSW 8 34,061,768 (GRCm39) missense possibly damaging 0.73
R5439:Tex15 UTSW 8 34,064,199 (GRCm39) missense possibly damaging 0.93
R5537:Tex15 UTSW 8 34,061,641 (GRCm39) missense probably damaging 1.00
R5580:Tex15 UTSW 8 34,062,457 (GRCm39) missense probably damaging 1.00
R5588:Tex15 UTSW 8 34,067,215 (GRCm39) missense probably damaging 1.00
R5696:Tex15 UTSW 8 34,063,220 (GRCm39) missense probably benign 0.01
R5734:Tex15 UTSW 8 34,036,364 (GRCm39) missense probably benign 0.01
R5756:Tex15 UTSW 8 34,065,861 (GRCm39) missense probably benign 0.17
R5823:Tex15 UTSW 8 34,060,962 (GRCm39) missense possibly damaging 0.67
R6126:Tex15 UTSW 8 34,063,591 (GRCm39) missense probably benign 0.19
R6129:Tex15 UTSW 8 34,064,158 (GRCm39) missense possibly damaging 0.90
R6276:Tex15 UTSW 8 34,067,217 (GRCm39) missense possibly damaging 0.93
R6374:Tex15 UTSW 8 34,065,940 (GRCm39) missense probably damaging 1.00
R6430:Tex15 UTSW 8 34,061,329 (GRCm39) missense probably benign 0.01
R6452:Tex15 UTSW 8 34,062,844 (GRCm39) missense probably damaging 1.00
R6471:Tex15 UTSW 8 34,071,762 (GRCm39) missense probably damaging 1.00
R6700:Tex15 UTSW 8 34,064,917 (GRCm39) missense possibly damaging 0.93
R6918:Tex15 UTSW 8 34,063,212 (GRCm39) missense probably benign 0.27
R6958:Tex15 UTSW 8 34,060,899 (GRCm39) missense probably benign 0.01
R6970:Tex15 UTSW 8 34,047,456 (GRCm39) missense probably benign 0.03
R7059:Tex15 UTSW 8 34,064,758 (GRCm39) missense possibly damaging 0.57
R7069:Tex15 UTSW 8 34,060,748 (GRCm39) missense probably benign
R7072:Tex15 UTSW 8 34,065,459 (GRCm39) missense possibly damaging 0.85
R7212:Tex15 UTSW 8 34,063,023 (GRCm39) missense probably damaging 1.00
R7212:Tex15 UTSW 8 34,060,854 (GRCm39) nonsense probably null
R7216:Tex15 UTSW 8 34,063,014 (GRCm39) missense possibly damaging 0.93
R7219:Tex15 UTSW 8 34,036,268 (GRCm39) missense probably benign 0.40
R7313:Tex15 UTSW 8 34,064,845 (GRCm39) missense possibly damaging 0.82
R7315:Tex15 UTSW 8 34,071,544 (GRCm39) missense probably benign 0.01
R7444:Tex15 UTSW 8 34,066,590 (GRCm39) missense possibly damaging 0.92
R7455:Tex15 UTSW 8 34,067,025 (GRCm39) missense possibly damaging 0.91
R7643:Tex15 UTSW 8 34,065,148 (GRCm39) missense probably damaging 1.00
R7644:Tex15 UTSW 8 34,064,445 (GRCm39) missense probably benign 0.01
R7724:Tex15 UTSW 8 34,036,291 (GRCm39) missense possibly damaging 0.60
R7779:Tex15 UTSW 8 34,065,309 (GRCm39) missense probably damaging 1.00
R7798:Tex15 UTSW 8 34,071,875 (GRCm39) missense possibly damaging 0.69
R7816:Tex15 UTSW 8 34,071,683 (GRCm39) missense probably benign 0.14
R7820:Tex15 UTSW 8 34,065,090 (GRCm39) missense probably damaging 0.98
R8041:Tex15 UTSW 8 34,065,874 (GRCm39) missense probably damaging 1.00
R8150:Tex15 UTSW 8 34,063,534 (GRCm39) missense probably benign 0.06
R8152:Tex15 UTSW 8 34,062,921 (GRCm39) missense possibly damaging 0.82
R8237:Tex15 UTSW 8 34,067,427 (GRCm39) missense possibly damaging 0.72
R8250:Tex15 UTSW 8 34,055,233 (GRCm39) missense probably null 0.27
R8264:Tex15 UTSW 8 34,072,390 (GRCm39) missense probably benign 0.18
R8279:Tex15 UTSW 8 34,061,765 (GRCm39) missense probably damaging 0.96
R8353:Tex15 UTSW 8 34,066,899 (GRCm39) nonsense probably null
R8388:Tex15 UTSW 8 34,065,237 (GRCm39) missense probably benign 0.00
R8432:Tex15 UTSW 8 34,066,572 (GRCm39) missense probably damaging 0.99
R8453:Tex15 UTSW 8 34,066,899 (GRCm39) nonsense probably null
R8489:Tex15 UTSW 8 34,067,574 (GRCm39) missense probably benign 0.02
R8670:Tex15 UTSW 8 34,064,746 (GRCm39) missense probably benign 0.19
R8703:Tex15 UTSW 8 34,062,724 (GRCm39) missense probably benign 0.00
R8871:Tex15 UTSW 8 34,066,992 (GRCm39) missense possibly damaging 0.62
R8945:Tex15 UTSW 8 34,064,724 (GRCm39) missense probably benign 0.00
R9104:Tex15 UTSW 8 34,060,950 (GRCm39) missense possibly damaging 0.86
R9132:Tex15 UTSW 8 34,067,554 (GRCm39) missense possibly damaging 0.84
R9207:Tex15 UTSW 8 34,065,784 (GRCm39) missense probably damaging 1.00
R9210:Tex15 UTSW 8 34,064,319 (GRCm39) missense possibly damaging 0.91
R9330:Tex15 UTSW 8 34,065,143 (GRCm39) missense probably benign 0.01
R9354:Tex15 UTSW 8 34,063,344 (GRCm39) missense possibly damaging 0.86
R9365:Tex15 UTSW 8 34,064,564 (GRCm39) missense possibly damaging 0.56
R9440:Tex15 UTSW 8 34,072,273 (GRCm39) missense possibly damaging 0.90
R9534:Tex15 UTSW 8 34,060,999 (GRCm39) missense probably benign 0.45
R9570:Tex15 UTSW 8 34,067,309 (GRCm39) missense probably damaging 0.96
R9574:Tex15 UTSW 8 34,064,509 (GRCm39) missense probably benign 0.09
R9618:Tex15 UTSW 8 34,062,397 (GRCm39) missense probably benign 0.35
R9655:Tex15 UTSW 8 34,066,784 (GRCm39) nonsense probably null
R9786:Tex15 UTSW 8 34,062,457 (GRCm39) missense probably damaging 1.00
R9798:Tex15 UTSW 8 34,062,721 (GRCm39) missense probably damaging 0.98
RF005:Tex15 UTSW 8 34,066,705 (GRCm39) missense probably benign 0.05
X0020:Tex15 UTSW 8 34,066,607 (GRCm39) missense probably benign 0.03
X0065:Tex15 UTSW 8 34,065,545 (GRCm39) nonsense probably null
Z1088:Tex15 UTSW 8 34,061,343 (GRCm39) missense possibly damaging 0.89
Z1088:Tex15 UTSW 8 34,064,898 (GRCm39) missense probably benign
Z1088:Tex15 UTSW 8 34,061,838 (GRCm39) missense possibly damaging 0.68
Z1176:Tex15 UTSW 8 34,064,754 (GRCm39) missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- TCAAACTGTAGGCTGAACAAAGC -3'
(R):5'- TTGGCAGCCAATTAGCTCAG -3'

Sequencing Primer
(F):5'- CTGTAGGCTGAACAAAGCTTGGC -3'
(R):5'- GAGCATACCTCGAAATCTCTGGTTG -3'
Posted On 2014-06-23