Incidental Mutation 'R1843:Pknox2'
ID 207443
Institutional Source Beutler Lab
Gene Symbol Pknox2
Ensembl Gene ENSMUSG00000035934
Gene Name Pbx/knotted 1 homeobox 2
Synonyms D230005H23Rik, Prep2
MMRRC Submission 039868-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.740) question?
Stock # R1843 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 36802275-37058638 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 36866127 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 5 (M5K)
Ref Sequence ENSEMBL: ENSMUSP00000135641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039674] [ENSMUST00000080754] [ENSMUST00000175938] [ENSMUST00000188057] [ENSMUST00000188348] [ENSMUST00000177444] [ENSMUST00000189294] [ENSMUST00000177218]
AlphaFold Q8BG99
Predicted Effect probably benign
Transcript: ENSMUST00000039674
AA Change: M30K

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000035806
Gene: ENSMUSG00000035934
AA Change: M30K

DomainStartEndE-ValueType
HOX 288 353 8.54e-12 SMART
low complexity region 415 424 N/A INTRINSIC
coiled coil region 428 465 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000080754
AA Change: M30K

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000079578
Gene: ENSMUSG00000035934
AA Change: M30K

DomainStartEndE-ValueType
HOX 288 353 8.54e-12 SMART
low complexity region 415 424 N/A INTRINSIC
coiled coil region 428 465 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175938
Predicted Effect probably benign
Transcript: ENSMUST00000176471
AA Change: M30K

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000135249
Gene: ENSMUSG00000035934
AA Change: M30K

DomainStartEndE-ValueType
Pfam:Meis_PKNOX_N 96 181 4.6e-42 PFAM
HOX 288 353 8.54e-12 SMART
low complexity region 415 424 N/A INTRINSIC
coiled coil region 428 465 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176562
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176622
Predicted Effect possibly damaging
Transcript: ENSMUST00000188057
AA Change: M30K

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000188348
AA Change: M30K

PolyPhen 2 Score 0.600 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000177444
AA Change: M5K

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000189294
AA Change: M30K

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000177218
AA Change: M30K

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000135581
Gene: ENSMUSG00000035934
AA Change: M30K

DomainStartEndE-ValueType
HOX 288 353 8.54e-12 SMART
low complexity region 415 424 N/A INTRINSIC
coiled coil region 428 465 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177080
SMART Domains Protein: ENSMUSP00000135444
Gene: ENSMUSG00000035934

DomainStartEndE-ValueType
HOX 259 324 4.4e-14 SMART
low complexity region 386 395 N/A INTRINSIC
coiled coil region 399 436 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Homeodomain proteins are sequence-specific transcription factors that share a highly conserved DNA-binding domain and play fundamental roles in cell proliferation, differentiation, and death. PKNOX2 belongs to the TALE (3-amino acid loop extension) class of homeodomain proteins characterized by a 3-amino acid extension between alpha helices 1 and 2 within the homeodomain (Imoto et al., 2001 [PubMed 11549286]).[supplied by OMIM, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik C T 8: 106,435,606 (GRCm39) T88M probably damaging Het
9430038I01Rik A G 7: 136,978,795 (GRCm39) probably benign Het
Adgra3 A C 5: 50,118,834 (GRCm39) S905A probably damaging Het
Adgrv1 A G 13: 81,692,652 (GRCm39) Y1618H probably damaging Het
Anapc15-ps T C 10: 95,509,176 (GRCm39) T26A probably benign Het
Ankrd13d T C 19: 4,321,623 (GRCm39) K360E probably damaging Het
Anks1b T A 10: 90,348,751 (GRCm39) probably null Het
Apob T C 12: 8,057,602 (GRCm39) F2028S possibly damaging Het
Arap3 G A 18: 38,108,636 (GRCm39) R1265W probably damaging Het
Arhgef37 A G 18: 61,651,121 (GRCm39) Y135H probably damaging Het
Armh3 A C 19: 45,963,691 (GRCm39) S42R probably benign Het
Atp1a1 T C 3: 101,489,333 (GRCm39) T760A probably benign Het
Cdc42bpb T A 12: 111,289,255 (GRCm39) M497L probably benign Het
Ces5a C T 8: 94,240,859 (GRCm39) V413M probably damaging Het
Chd5 A T 4: 152,470,263 (GRCm39) Y1903F probably damaging Het
Chd9 T A 8: 91,737,422 (GRCm39) N1500K probably benign Het
Chmp7 G T 14: 69,957,248 (GRCm39) D303E probably benign Het
Chrnb4 A T 9: 54,942,102 (GRCm39) Y391N possibly damaging Het
Crtc1 T C 8: 70,840,802 (GRCm39) T475A probably benign Het
Cyp2c69 A G 19: 39,865,972 (GRCm39) I207T probably benign Het
Dcp1a A G 14: 30,240,940 (GRCm39) E250G probably damaging Het
Ddx20 T C 3: 105,586,398 (GRCm39) Q649R probably benign Het
Defb12 T A 8: 19,162,754 (GRCm39) K59N probably damaging Het
Dpy19l3 A T 7: 35,429,185 (GRCm39) I85N probably damaging Het
Duox2 C T 2: 122,122,739 (GRCm39) probably null Het
Ebi3 T A 17: 56,263,679 (GRCm39) Y197N probably damaging Het
Emc1 G A 4: 139,102,823 (GRCm39) R994Q probably benign Het
Ercc6 G T 14: 32,268,777 (GRCm39) M530I probably damaging Het
Evl T A 12: 108,619,255 (GRCm39) D70E probably damaging Het
Fbln2 A G 6: 91,242,757 (GRCm39) N819S probably damaging Het
Foxk2 A G 11: 121,176,363 (GRCm39) I170V probably benign Het
Gfm1 T C 3: 67,342,943 (GRCm39) V159A probably damaging Het
Gm10837 A G 14: 122,728,177 (GRCm39) T18A unknown Het
Gm12887 A T 4: 121,479,227 (GRCm39) V25E probably damaging Het
Hectd4 A G 5: 121,435,243 (GRCm39) H985R possibly damaging Het
Hsfy2 A G 1: 56,675,791 (GRCm39) Y249H possibly damaging Het
Hspg2 T C 4: 137,272,878 (GRCm39) V2639A probably damaging Het
Igf2r A G 17: 12,923,157 (GRCm39) probably null Het
Invs T A 4: 48,422,035 (GRCm39) I889N probably damaging Het
Kcnq1 A T 7: 142,736,857 (GRCm39) M209L probably benign Het
Klra7 A G 6: 130,206,957 (GRCm39) I48T possibly damaging Het
Krt26 CTAGTA CTA 11: 99,224,352 (GRCm39) probably benign Het
Lrif1 T A 3: 106,640,127 (GRCm39) V404D probably damaging Het
Lrriq1 T A 10: 103,063,034 (GRCm39) probably null Het
Lypd6 T A 2: 50,078,774 (GRCm39) I90N possibly damaging Het
Mbp A G 18: 82,602,247 (GRCm39) D174G probably damaging Het
Megf9 G T 4: 70,453,022 (GRCm39) P13Q probably damaging Het
Myo15b A T 11: 115,760,412 (GRCm39) T1155S probably benign Het
Nherf2 C T 17: 24,860,693 (GRCm39) S150N possibly damaging Het
Nlrp6 T A 7: 140,503,006 (GRCm39) C371S probably damaging Het
Nosip T A 7: 44,726,733 (GRCm39) probably null Het
Nox3 G T 17: 3,720,153 (GRCm39) P344H probably damaging Het
Nup210l T C 3: 90,079,393 (GRCm39) V959A probably damaging Het
Or10d1 A G 9: 39,484,031 (GRCm39) Y175H possibly damaging Het
Or2b2b C A 13: 21,858,842 (GRCm39) V91L probably benign Het
Or2k2 T C 4: 58,785,384 (GRCm39) I113V probably benign Het
Or5b119 A G 19: 13,457,295 (GRCm39) I89T probably benign Het
Or5k8 T A 16: 58,644,440 (GRCm39) I211F probably damaging Het
Osbpl3 A C 6: 50,347,123 (GRCm39) S25A probably damaging Het
Otog G A 7: 45,895,707 (GRCm39) C107Y probably damaging Het
Pax7 G A 4: 139,511,802 (GRCm39) R260C probably damaging Het
Pbrm1 A T 14: 30,760,914 (GRCm39) I224F probably damaging Het
Pcdh1 T A 18: 38,325,278 (GRCm39) probably null Het
Pcnx1 T C 12: 82,027,709 (GRCm39) L1585P probably damaging Het
Pde4c C T 8: 71,200,599 (GRCm39) H362Y probably damaging Het
Pdlim2 C T 14: 70,402,228 (GRCm39) R296H probably damaging Het
Pgm1 A T 4: 99,818,675 (GRCm39) Q90L probably damaging Het
Phlpp1 A G 1: 106,271,235 (GRCm39) H814R probably benign Het
Pole G A 5: 110,478,701 (GRCm39) probably null Het
Polr1b A G 2: 128,944,886 (GRCm39) I61V probably benign Het
Prelp T C 1: 133,842,495 (GRCm39) K217E probably damaging Het
Prkce C T 17: 86,782,974 (GRCm39) Q202* probably null Het
Psmd2 T G 16: 20,475,332 (GRCm39) M370R probably benign Het
Rimklb A T 6: 122,440,968 (GRCm39) H68Q probably damaging Het
Rnasel A G 1: 153,630,420 (GRCm39) D312G possibly damaging Het
Rxrg A T 1: 167,426,321 (GRCm39) M1L probably benign Het
Scrn1 A G 6: 54,499,826 (GRCm39) F220L possibly damaging Het
Scyl3 A G 1: 163,778,244 (GRCm39) S461G probably benign Het
Serpina1c T A 12: 103,861,282 (GRCm39) T411S probably benign Het
Serpinb6d C T 13: 33,855,364 (GRCm39) P346L probably benign Het
Shld2 A G 14: 33,989,760 (GRCm39) I382T probably benign Het
Spg21 G T 9: 65,372,618 (GRCm39) V17F probably damaging Het
Spink5 A T 18: 44,132,958 (GRCm39) M525L probably benign Het
Sun2 T C 15: 79,621,764 (GRCm39) T155A probably benign Het
Tchh T A 3: 93,354,087 (GRCm39) F1176I unknown Het
Tex15 T A 8: 34,066,682 (GRCm39) D2037E probably benign Het
Tfdp2 T C 9: 96,199,857 (GRCm39) C392R possibly damaging Het
Tmem30c T C 16: 57,097,143 (GRCm39) N139S probably benign Het
Tns2 C T 15: 102,021,568 (GRCm39) probably null Het
Trim66 T C 7: 109,075,046 (GRCm39) E405G probably damaging Het
Trpc4 T A 3: 54,187,415 (GRCm39) F456I probably benign Het
Tspo2 T C 17: 48,755,818 (GRCm39) D108G possibly damaging Het
Tyk2 A T 9: 21,032,850 (GRCm39) C304* probably null Het
Vgll4 A T 6: 114,839,756 (GRCm39) S185T probably benign Het
Vmn2r94 A C 17: 18,464,732 (GRCm39) S519R probably benign Het
Vmn2r96 T G 17: 18,818,183 (GRCm39) S587A probably benign Het
Vps4b C A 1: 106,706,712 (GRCm39) A287S possibly damaging Het
Yeats2 C T 16: 20,048,314 (GRCm39) P1332S probably benign Het
Zfp462 T G 4: 55,010,010 (GRCm39) S659A possibly damaging Het
Zfp507 C T 7: 35,493,150 (GRCm39) R631Q probably damaging Het
Zfp764l1 A C 7: 126,990,660 (GRCm39) D442E probably benign Het
Zswim5 G T 4: 116,734,896 (GRCm39) E80D unknown Het
Other mutations in Pknox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01894:Pknox2 APN 9 36,835,038 (GRCm39) missense probably damaging 1.00
IGL02019:Pknox2 APN 9 36,834,929 (GRCm39) missense probably damaging 1.00
IGL02706:Pknox2 APN 9 36,847,675 (GRCm39) missense probably benign 0.18
IGL03018:Pknox2 APN 9 36,865,993 (GRCm39) missense probably damaging 1.00
IGL03374:Pknox2 APN 9 36,834,966 (GRCm39) missense probably damaging 0.98
PIT4494001:Pknox2 UTSW 9 36,865,987 (GRCm39) critical splice donor site probably null
R0585:Pknox2 UTSW 9 36,821,056 (GRCm39) splice site probably benign
R1786:Pknox2 UTSW 9 36,820,980 (GRCm39) missense probably damaging 1.00
R1861:Pknox2 UTSW 9 36,834,957 (GRCm39) missense probably damaging 1.00
R2252:Pknox2 UTSW 9 36,821,816 (GRCm39) missense probably benign 0.12
R2696:Pknox2 UTSW 9 36,820,987 (GRCm39) nonsense probably null
R2843:Pknox2 UTSW 9 36,805,624 (GRCm39) missense probably benign 0.00
R4576:Pknox2 UTSW 9 36,834,844 (GRCm39) intron probably benign
R4632:Pknox2 UTSW 9 36,805,709 (GRCm39) missense probably benign 0.00
R4705:Pknox2 UTSW 9 36,834,934 (GRCm39) missense possibly damaging 0.92
R4754:Pknox2 UTSW 9 36,821,016 (GRCm39) missense probably damaging 0.98
R5974:Pknox2 UTSW 9 36,847,618 (GRCm39) missense probably damaging 1.00
R5984:Pknox2 UTSW 9 36,835,022 (GRCm39) missense probably damaging 1.00
R7014:Pknox2 UTSW 9 36,820,963 (GRCm39) missense probably damaging 1.00
R7387:Pknox2 UTSW 9 36,868,364 (GRCm39) intron probably benign
R7488:Pknox2 UTSW 9 36,866,127 (GRCm39) missense probably benign 0.26
R7769:Pknox2 UTSW 9 36,806,602 (GRCm39) splice site probably null
R8221:Pknox2 UTSW 9 36,821,040 (GRCm39) missense possibly damaging 0.86
R8296:Pknox2 UTSW 9 36,822,459 (GRCm39) missense probably benign 0.31
R8470:Pknox2 UTSW 9 36,834,986 (GRCm39) missense probably damaging 1.00
R8677:Pknox2 UTSW 9 36,821,887 (GRCm39) missense probably damaging 0.97
R8906:Pknox2 UTSW 9 36,804,167 (GRCm39) missense possibly damaging 0.82
R9026:Pknox2 UTSW 9 36,821,044 (GRCm39) missense possibly damaging 0.84
R9401:Pknox2 UTSW 9 36,835,041 (GRCm39) missense probably damaging 1.00
R9468:Pknox2 UTSW 9 36,822,495 (GRCm39) missense probably benign 0.00
R9565:Pknox2 UTSW 9 36,835,067 (GRCm39) missense probably damaging 1.00
R9582:Pknox2 UTSW 9 36,804,252 (GRCm39) missense probably damaging 0.97
RF016:Pknox2 UTSW 9 36,820,905 (GRCm39) critical splice donor site probably benign
RF061:Pknox2 UTSW 9 36,820,905 (GRCm39) critical splice donor site probably benign
X0063:Pknox2 UTSW 9 36,835,065 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGACTCTCTGATCTGCATCC -3'
(R):5'- CACTCCCTGGTTACTACGTG -3'

Sequencing Primer
(F):5'- TGCATCCTCATATATCAGCTAAGGC -3'
(R):5'- CTCCCTGGTTACTACGTGTTGTTTTG -3'
Posted On 2014-06-23