Incidental Mutation 'R0115:Kcnma1'
ID20745
Institutional Source Beutler Lab
Gene Symbol Kcnma1
Ensembl Gene ENSMUSG00000063142
Gene Namepotassium large conductance calcium-activated channel, subfamily M, alpha member 1
SynonymsmSlo1, MaxiK, Slo1, 5730414M22Rik, BK channel alpha subunit, BKCa, Slo
MMRRC Submission 038401-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.854) question?
Stock #R0115 (G1)
Quality Score225
Status Validated (trace)
Chromosome14
Chromosomal Location23289431-24014491 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 23314175 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 980 (R980L)
Ref Sequence ENSEMBL: ENSMUSP00000152959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065788] [ENSMUST00000074983] [ENSMUST00000100831] [ENSMUST00000112423] [ENSMUST00000145596] [ENSMUST00000163322] [ENSMUST00000172099] [ENSMUST00000177634] [ENSMUST00000179097] [ENSMUST00000179836] [ENSMUST00000188210] [ENSMUST00000188285] [ENSMUST00000188991] [ENSMUST00000190044] [ENSMUST00000190985] [ENSMUST00000223655] [ENSMUST00000223727] [ENSMUST00000223749] [ENSMUST00000224077] [ENSMUST00000224232] [ENSMUST00000224285] [ENSMUST00000224468] [ENSMUST00000224787] [ENSMUST00000224812] [ENSMUST00000225315] [ENSMUST00000225431] [ENSMUST00000225471] [ENSMUST00000225556] [ENSMUST00000225794]
Predicted Effect probably damaging
Transcript: ENSMUST00000065788
AA Change: R917L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000065293
Gene: ENSMUSG00000063142
AA Change: R917L

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 2.2e-18 PFAM
Pfam:Ion_trans_2 180 268 5.7e-16 PFAM
Pfam:TrkA_N 314 413 7.5e-7 PFAM
Pfam:BK_channel_a 411 509 6.4e-31 PFAM
low complexity region 835 843 N/A INTRINSIC
low complexity region 891 902 N/A INTRINSIC
low complexity region 1005 1031 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000074983
AA Change: R976L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000074511
Gene: ENSMUSG00000063142
AA Change: R976L

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 2.2e-18 PFAM
Pfam:Ion_trans_2 180 268 5.7e-16 PFAM
Pfam:TrkA_N 314 413 7.5e-7 PFAM
Pfam:BK_channel_a 411 509 6.4e-31 PFAM
low complexity region 894 902 N/A INTRINSIC
low complexity region 950 961 N/A INTRINSIC
low complexity region 1064 1090 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100831
AA Change: R947L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098393
Gene: ENSMUSG00000063142
AA Change: R947L

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 2.1e-18 PFAM
Pfam:Ion_trans_2 180 268 5.5e-16 PFAM
Pfam:TrkA_N 314 413 7.3e-7 PFAM
Pfam:BK_channel_a 411 509 6.2e-31 PFAM
low complexity region 865 873 N/A INTRINSIC
low complexity region 921 932 N/A INTRINSIC
low complexity region 1035 1061 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112423
AA Change: R863L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108042
Gene: ENSMUSG00000063142
AA Change: R863L

DomainStartEndE-ValueType
transmembrane domain 2 19 N/A INTRINSIC
Pfam:Ion_trans 37 208 2.1e-18 PFAM
Pfam:Ion_trans_2 126 214 5.3e-16 PFAM
Pfam:TrkA_N 260 359 7e-7 PFAM
Pfam:BK_channel_a 357 455 6e-31 PFAM
low complexity region 781 789 N/A INTRINSIC
low complexity region 837 848 N/A INTRINSIC
low complexity region 951 977 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000145596
AA Change: R1070L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000163322
AA Change: R914L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128553
Gene: ENSMUSG00000063142
AA Change: R914L

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 3.2e-18 PFAM
Pfam:Ion_trans_2 180 268 1.1e-15 PFAM
Pfam:TrkA_N 314 413 7e-7 PFAM
Pfam:BK_channel_a 411 509 6e-31 PFAM
low complexity region 832 840 N/A INTRINSIC
low complexity region 888 899 N/A INTRINSIC
low complexity region 1002 1028 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172099
AA Change: R979L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132204
Gene: ENSMUSG00000063142
AA Change: R979L

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 2.2e-18 PFAM
Pfam:Ion_trans_2 180 268 5.7e-16 PFAM
Pfam:TrkA_N 314 413 7.6e-7 PFAM
Pfam:BK_channel_a 411 509 6.5e-31 PFAM
low complexity region 897 905 N/A INTRINSIC
low complexity region 953 964 N/A INTRINSIC
low complexity region 1067 1093 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177634
AA Change: R944L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136447
Gene: ENSMUSG00000063142
AA Change: R944L

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
Pfam:Ion_trans 53 272 4.9e-19 PFAM
Pfam:Ion_trans_2 180 267 1.2e-15 PFAM
Pfam:BK_channel_a 413 508 1.2e-35 PFAM
low complexity region 862 870 N/A INTRINSIC
low complexity region 918 929 N/A INTRINSIC
low complexity region 1032 1058 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179097
AA Change: R941L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136568
Gene: ENSMUSG00000063142
AA Change: R941L

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 4.6e-18 PFAM
Pfam:Ion_trans_2 180 268 1e-15 PFAM
Pfam:TrkA_N 314 413 1.1e-7 PFAM
Pfam:BK_channel_a 411 509 3.2e-31 PFAM
low complexity region 859 867 N/A INTRINSIC
low complexity region 915 926 N/A INTRINSIC
low complexity region 1029 1055 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179836
AA Change: R920L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137141
Gene: ENSMUSG00000063142
AA Change: R920L

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 4.2e-18 PFAM
Pfam:Ion_trans_2 180 268 9.5e-16 PFAM
Pfam:BK_channel_a 389 457 2.4e-15 PFAM
low complexity region 838 846 N/A INTRINSIC
low complexity region 894 905 N/A INTRINSIC
low complexity region 1008 1034 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000188210
AA Change: R1001L

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141069
Gene: ENSMUSG00000063142
AA Change: R1001L

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
Pfam:Ion_trans 216 387 1.3e-18 PFAM
Pfam:Ion_trans_2 305 393 5.2e-16 PFAM
Pfam:TrkA_N 439 538 7.8e-7 PFAM
Pfam:BK_channel_a 536 634 5e-31 PFAM
low complexity region 988 996 N/A INTRINSIC
low complexity region 1044 1055 N/A INTRINSIC
low complexity region 1158 1184 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188285
AA Change: R1101L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140275
Gene: ENSMUSG00000063142
AA Change: R1101L

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
Pfam:Ion_trans 216 387 1.3e-18 PFAM
Pfam:Ion_trans_2 305 393 5.4e-16 PFAM
Pfam:TrkA_N 439 538 8e-7 PFAM
Pfam:BK_channel_a 536 634 5.2e-31 PFAM
low complexity region 1019 1027 N/A INTRINSIC
low complexity region 1075 1086 N/A INTRINSIC
low complexity region 1189 1215 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188991
AA Change: R1097L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140751
Gene: ENSMUSG00000063142
AA Change: R1097L

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
Pfam:Ion_trans 216 387 3.3e-18 PFAM
Pfam:Ion_trans_2 305 393 1.1e-15 PFAM
Pfam:TrkA_N 439 538 3.7e-7 PFAM
Pfam:BK_channel_a 536 634 3.4e-31 PFAM
low complexity region 1015 1023 N/A INTRINSIC
low complexity region 1071 1082 N/A INTRINSIC
low complexity region 1185 1211 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190044
AA Change: R1039L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140033
Gene: ENSMUSG00000063142
AA Change: R1039L

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
Pfam:Ion_trans 216 387 1.3e-18 PFAM
Pfam:Ion_trans_2 305 393 5.1e-16 PFAM
Pfam:TrkA_N 439 538 7.5e-7 PFAM
Pfam:BK_channel_a 536 634 4.9e-31 PFAM
low complexity region 957 965 N/A INTRINSIC
low complexity region 1013 1024 N/A INTRINSIC
low complexity region 1127 1153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190985
Predicted Effect probably damaging
Transcript: ENSMUST00000223655
AA Change: R1036L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000223727
AA Change: R974L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000223749
AA Change: R974L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect unknown
Transcript: ENSMUST00000224025
AA Change: R992L
Predicted Effect probably damaging
Transcript: ENSMUST00000224077
AA Change: R1039L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000224232
AA Change: R1032L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000224285
AA Change: R974L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000224468
AA Change: R1104L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000224787
AA Change: R923L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000224812
AA Change: R1007L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000225315
AA Change: R1003L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000225431
AA Change: R974L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000225471
AA Change: R1003L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000225556
AA Change: R980L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000225794
Meta Mutation Damage Score 0.6076 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.2%
  • 20x: 86.0%
Validation Efficiency 98% (98/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MaxiK channels are large conductance, voltage and calcium-sensitive potassium channels which are fundamental to the control of smooth muscle tone and neuronal excitability. MaxiK channels can be formed by 2 subunits: the pore-forming alpha subunit, which is the product of this gene, and the modulatory beta subunit. Intracellular calcium regulates the physical association between the alpha and beta subunits. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to cerebellar ataxia, Purkinje cell dysfunction, uneven gait patterns, bladder hyperactivity, urinary incontinence, abnormal colonic K+ secretion, and hearing impairment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik G A 18: 57,594,142 probably benign Het
2310007B03Rik A T 1: 93,159,725 S135R possibly damaging Het
4921528I07Rik A G 9: 114,279,384 noncoding transcript Het
Alas1 A T 9: 106,238,252 probably null Het
Arf5 A G 6: 28,426,076 Y154C probably damaging Het
Arhgap20 T A 9: 51,838,972 I344N probably damaging Het
Arhgap30 A C 1: 171,407,948 E630A possibly damaging Het
B4galt5 A G 2: 167,309,234 L118P probably damaging Het
Bdp1 A G 13: 100,041,454 I1969T probably benign Het
Bysl C T 17: 47,610,942 R77Q probably benign Het
Cap1 A T 4: 122,863,075 H272Q possibly damaging Het
Ccdc146 T C 5: 21,322,756 I187M possibly damaging Het
Cdk13 C A 13: 17,719,494 A1123S probably damaging Het
Ces5a A T 8: 93,502,183 M473K probably damaging Het
Chd8 A G 14: 52,237,206 S123P probably benign Het
Cwc22 G A 2: 77,908,111 A497V probably damaging Het
Cwh43 T C 5: 73,418,027 S296P probably damaging Het
Cyp2c50 T A 19: 40,092,393 probably benign Het
Dlg1 C A 16: 31,805,690 Y399* probably null Het
Drosha A T 15: 12,846,130 E92D probably benign Het
Fanca C T 8: 123,268,539 G1408D probably benign Het
Frem1 T A 4: 82,936,169 D1621V possibly damaging Het
Frem2 G A 3: 53,656,208 R293C probably damaging Het
Fut8 T A 12: 77,448,560 V308D probably damaging Het
Glipr1 A G 10: 111,993,541 I105T probably benign Het
Glmn A T 5: 107,560,934 S385T probably benign Het
Gm281 A G 14: 13,899,571 V117A probably damaging Het
Gon4l T A 3: 88,895,682 V1200D probably damaging Het
Gpc1 G A 1: 92,857,499 D387N probably damaging Het
Gsdmc A G 15: 63,803,637 Y110H probably damaging Het
Gucy1b1 T A 3: 82,034,391 H586L probably benign Het
Gucy2e A G 11: 69,236,632 L5P unknown Het
Hectd4 A G 5: 121,295,506 probably benign Het
Hmcn1 T A 1: 150,808,647 I391F possibly damaging Het
Hsf4 A T 8: 105,272,704 probably null Het
I830077J02Rik G A 3: 105,926,570 T90M probably damaging Het
Ino80 A T 2: 119,431,016 H722Q probably damaging Het
Kif1a A G 1: 93,046,778 probably benign Het
Klhdc7b A G 15: 89,388,521 H1202R probably benign Het
Lig3 A G 11: 82,793,935 D559G probably damaging Het
Lyst T C 13: 13,677,952 V2179A probably benign Het
Mansc4 A G 6: 147,075,227 I297T possibly damaging Het
March6 A T 15: 31,475,812 F633I probably benign Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Megf10 G T 18: 57,259,802 V424L possibly damaging Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mib2 A G 4: 155,656,062 probably benign Het
Mut C T 17: 40,956,227 T564M probably damaging Het
Myh8 A G 11: 67,306,264 probably benign Het
Mypn T C 10: 63,192,380 probably benign Het
Nf1 G A 11: 79,468,876 probably null Het
Notch3 T A 17: 32,133,462 T1866S possibly damaging Het
Olfr108 C T 17: 37,445,779 A86V probably benign Het
Olfr1189 A T 2: 88,592,655 I284F probably damaging Het
Olfr1301 T A 2: 111,754,585 M112K probably damaging Het
Olfr390 A G 11: 73,787,315 I126V possibly damaging Het
Pkhd1 A T 1: 20,350,490 I2464N probably damaging Het
Pkn1 A G 8: 83,671,029 S817P probably damaging Het
Prkg2 A T 5: 98,994,655 probably null Het
Prl8a6 T C 13: 27,433,101 D201G probably benign Het
Psmd1 C T 1: 86,083,271 T356I possibly damaging Het
Ptk6 G A 2: 181,202,527 probably benign Het
Ptprn2 T C 12: 117,211,846 probably benign Het
Rbm42 G A 7: 30,647,775 T106I probably damaging Het
Rims4 A T 2: 163,864,120 V198E probably damaging Het
Ripk1 T C 13: 34,009,750 S32P probably damaging Het
Rorc T C 3: 94,377,609 probably benign Het
Rpl22l1 T C 3: 28,806,536 F15L probably damaging Het
Slc6a20a C A 9: 123,678,758 A17S possibly damaging Het
Sorcs1 A G 19: 50,636,453 probably benign Het
Sp100 A G 1: 85,650,131 probably benign Het
Ssc5d G A 7: 4,927,881 probably benign Het
Taf11 A G 17: 27,907,661 L4P probably benign Het
Tm2d3 A G 7: 65,695,334 probably benign Het
Tmub2 T C 11: 102,288,375 probably null Het
Trim34a T A 7: 104,247,902 C58S probably damaging Het
Trpc3 T C 3: 36,624,417 I840V probably benign Het
Trpm6 T C 19: 18,829,952 V1020A probably damaging Het
Vmn1r214 T A 13: 23,035,294 Y319* probably null Het
Vmn1r59 T C 7: 5,454,116 N215S probably benign Het
Vmn2r74 T C 7: 85,957,356 M261V probably benign Het
Vmn2r89 T C 14: 51,456,120 F309S probably damaging Het
Wdr95 A T 5: 149,564,390 D163V probably damaging Het
Xirp2 T A 2: 67,509,909 F831L possibly damaging Het
Ythdc2 C T 18: 44,841,423 probably benign Het
Other mutations in Kcnma1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Kcnma1 APN 14 23314322 splice site probably benign
IGL01520:Kcnma1 APN 14 23501143 missense possibly damaging 0.94
IGL01977:Kcnma1 APN 14 23530299 splice site probably benign
IGL02140:Kcnma1 APN 14 23309045 missense probably damaging 1.00
IGL02165:Kcnma1 APN 14 23336967 missense possibly damaging 0.93
IGL02186:Kcnma1 APN 14 23526813 missense probably benign 0.28
IGL02268:Kcnma1 APN 14 23543076 missense probably damaging 1.00
IGL02353:Kcnma1 APN 14 23591613 missense probably damaging 1.00
IGL02360:Kcnma1 APN 14 23591613 missense probably damaging 1.00
IGL02491:Kcnma1 APN 14 23311689 missense probably damaging 1.00
IGL02552:Kcnma1 APN 14 23386259 critical splice donor site probably null
IGL02625:Kcnma1 APN 14 23363832 missense probably damaging 1.00
IGL02677:Kcnma1 APN 14 23463156 missense probably damaging 1.00
IGL02706:Kcnma1 APN 14 23309154 missense probably damaging 1.00
PIT4495001:Kcnma1 UTSW 14 23425597 missense probably benign 0.00
PIT4514001:Kcnma1 UTSW 14 23309035 splice site probably null
PIT4576001:Kcnma1 UTSW 14 23309035 splice site probably null
R0071:Kcnma1 UTSW 14 23526767 missense probably damaging 1.00
R0071:Kcnma1 UTSW 14 23526767 missense probably damaging 1.00
R0172:Kcnma1 UTSW 14 23803166 missense probably damaging 1.00
R0178:Kcnma1 UTSW 14 23526767 missense probably damaging 1.00
R0183:Kcnma1 UTSW 14 23508052 missense probably damaging 1.00
R0240:Kcnma1 UTSW 14 23494579 missense probably damaging 1.00
R0240:Kcnma1 UTSW 14 23494579 missense probably damaging 1.00
R0328:Kcnma1 UTSW 14 23373197 missense probably damaging 1.00
R0501:Kcnma1 UTSW 14 23311716 missense possibly damaging 0.80
R0631:Kcnma1 UTSW 14 23509784 splice site probably benign
R0668:Kcnma1 UTSW 14 23367495 missense probably damaging 1.00
R0811:Kcnma1 UTSW 14 23300018 missense probably damaging 0.96
R0812:Kcnma1 UTSW 14 23300018 missense probably damaging 0.96
R1080:Kcnma1 UTSW 14 23494607 missense probably damaging 1.00
R1419:Kcnma1 UTSW 14 23367642 missense probably damaging 0.99
R1446:Kcnma1 UTSW 14 23311724 missense probably damaging 1.00
R1454:Kcnma1 UTSW 14 23463200 missense probably damaging 1.00
R1651:Kcnma1 UTSW 14 23314194 missense probably damaging 1.00
R1826:Kcnma1 UTSW 14 23330929 missense probably damaging 1.00
R1827:Kcnma1 UTSW 14 23330929 missense probably damaging 1.00
R1828:Kcnma1 UTSW 14 23330929 missense probably damaging 1.00
R1864:Kcnma1 UTSW 14 23803162 missense probably damaging 1.00
R2002:Kcnma1 UTSW 14 23337029 missense probably damaging 0.99
R2140:Kcnma1 UTSW 14 23314220 missense probably damaging 1.00
R2278:Kcnma1 UTSW 14 23543083 nonsense probably null
R2866:Kcnma1 UTSW 14 23373207 missense probably benign 0.16
R2867:Kcnma1 UTSW 14 23373207 missense probably benign 0.16
R2867:Kcnma1 UTSW 14 23373207 missense probably benign 0.16
R2900:Kcnma1 UTSW 14 23803160 missense probably damaging 1.00
R3820:Kcnma1 UTSW 14 23299938 missense possibly damaging 0.66
R3821:Kcnma1 UTSW 14 23367611 missense probably damaging 1.00
R3901:Kcnma1 UTSW 14 23505255 missense probably damaging 0.98
R3975:Kcnma1 UTSW 14 24003747 critical splice donor site probably null
R3976:Kcnma1 UTSW 14 24003747 critical splice donor site probably null
R4352:Kcnma1 UTSW 14 23311652 missense probably damaging 1.00
R4517:Kcnma1 UTSW 14 23337029 missense probably damaging 1.00
R4598:Kcnma1 UTSW 14 23803160 missense probably damaging 1.00
R4604:Kcnma1 UTSW 14 23309038 critical splice donor site probably null
R4743:Kcnma1 UTSW 14 23803202 missense probably damaging 1.00
R4754:Kcnma1 UTSW 14 23363836 missense probably damaging 0.96
R4908:Kcnma1 UTSW 14 23309152 missense probably damaging 0.99
R4960:Kcnma1 UTSW 14 24004118 intron probably benign
R5175:Kcnma1 UTSW 14 23336038 critical splice donor site probably null
R5218:Kcnma1 UTSW 14 23463185 missense probably damaging 0.96
R5435:Kcnma1 UTSW 14 23528404 nonsense probably null
R5705:Kcnma1 UTSW 14 24003771 missense possibly damaging 0.73
R5746:Kcnma1 UTSW 14 23494567 missense probably damaging 1.00
R5780:Kcnma1 UTSW 14 23386351 nonsense probably null
R5793:Kcnma1 UTSW 14 23309035 splice site probably null
R6039:Kcnma1 UTSW 14 23309037 missense probably benign 0.42
R6039:Kcnma1 UTSW 14 23309037 missense probably benign 0.42
R6133:Kcnma1 UTSW 14 24003868 missense probably damaging 0.98
R6271:Kcnma1 UTSW 14 23509889 missense probably damaging 1.00
R6490:Kcnma1 UTSW 14 23336097 missense possibly damaging 0.46
R6704:Kcnma1 UTSW 14 24002814 nonsense probably null
R6822:Kcnma1 UTSW 14 24003744 splice site probably null
R6855:Kcnma1 UTSW 14 23367611 missense probably damaging 1.00
R6920:Kcnma1 UTSW 14 23526534 critical splice donor site probably null
R7017:Kcnma1 UTSW 14 23494643 missense possibly damaging 0.79
R7081:Kcnma1 UTSW 14 23300018 missense probably damaging 0.96
R7113:Kcnma1 UTSW 14 23463156 missense probably damaging 1.00
R7131:Kcnma1 UTSW 14 23367494 missense probably damaging 1.00
R7172:Kcnma1 UTSW 14 23526623 missense probably damaging 1.00
R7207:Kcnma1 UTSW 14 23309015 makesense probably null
R7308:Kcnma1 UTSW 14 23330935 missense probably damaging 0.99
R7371:Kcnma1 UTSW 14 23494570 missense possibly damaging 0.94
R7404:Kcnma1 UTSW 14 24002834 missense unknown
R7560:Kcnma1 UTSW 14 23530242 missense probably benign 0.15
R7693:Kcnma1 UTSW 14 23367612 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACACAGATGCCTAGCTTGTCACC -3'
(R):5'- CAGAGGTTGCCCTTCTTTGGATAGC -3'

Sequencing Primer
(F):5'- TTGTCACCATCCAACATAGGTC -3'
(R):5'- CAAAGTTGATGTTTAGGCTGACAG -3'
Posted On2013-04-11