Incidental Mutation 'R1843:Myo15b'
ID 207455
Institutional Source Beutler Lab
Gene Symbol Myo15b
Ensembl Gene ENSMUSG00000034427
Gene Name myosin XVB
Synonyms LOC217328, LOC380737, E330039G21Rik
MMRRC Submission 039868-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R1843 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 115749232-115783429 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 115760412 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 1155 (T1155S)
Ref Sequence ENSEMBL: ENSMUSP00000091439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093911]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000093911
AA Change: T1155S

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000091439
Gene: ENSMUSG00000034427
AA Change: T1155S

DomainStartEndE-ValueType
MYSc 1 640 2.4e-134 SMART
IQ 660 682 1.03e1 SMART
Pfam:MyTH4 837 945 2.1e-23 PFAM
low complexity region 1050 1068 N/A INTRINSIC
low complexity region 1136 1170 N/A INTRINSIC
low complexity region 1207 1246 N/A INTRINSIC
low complexity region 1302 1327 N/A INTRINSIC
low complexity region 1454 1468 N/A INTRINSIC
low complexity region 1489 1509 N/A INTRINSIC
SH3 1735 1792 1.15e-7 SMART
Pfam:MyTH4 1928 2029 8.3e-25 PFAM
B41 2032 2235 6.99e-4 SMART
low complexity region 2243 2253 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik C T 8: 106,435,606 (GRCm39) T88M probably damaging Het
9430038I01Rik A G 7: 136,978,795 (GRCm39) probably benign Het
Adgra3 A C 5: 50,118,834 (GRCm39) S905A probably damaging Het
Adgrv1 A G 13: 81,692,652 (GRCm39) Y1618H probably damaging Het
Anapc15-ps T C 10: 95,509,176 (GRCm39) T26A probably benign Het
Ankrd13d T C 19: 4,321,623 (GRCm39) K360E probably damaging Het
Anks1b T A 10: 90,348,751 (GRCm39) probably null Het
Apob T C 12: 8,057,602 (GRCm39) F2028S possibly damaging Het
Arap3 G A 18: 38,108,636 (GRCm39) R1265W probably damaging Het
Arhgef37 A G 18: 61,651,121 (GRCm39) Y135H probably damaging Het
Armh3 A C 19: 45,963,691 (GRCm39) S42R probably benign Het
Atp1a1 T C 3: 101,489,333 (GRCm39) T760A probably benign Het
Cdc42bpb T A 12: 111,289,255 (GRCm39) M497L probably benign Het
Ces5a C T 8: 94,240,859 (GRCm39) V413M probably damaging Het
Chd5 A T 4: 152,470,263 (GRCm39) Y1903F probably damaging Het
Chd9 T A 8: 91,737,422 (GRCm39) N1500K probably benign Het
Chmp7 G T 14: 69,957,248 (GRCm39) D303E probably benign Het
Chrnb4 A T 9: 54,942,102 (GRCm39) Y391N possibly damaging Het
Crtc1 T C 8: 70,840,802 (GRCm39) T475A probably benign Het
Cyp2c69 A G 19: 39,865,972 (GRCm39) I207T probably benign Het
Dcp1a A G 14: 30,240,940 (GRCm39) E250G probably damaging Het
Ddx20 T C 3: 105,586,398 (GRCm39) Q649R probably benign Het
Defb12 T A 8: 19,162,754 (GRCm39) K59N probably damaging Het
Dpy19l3 A T 7: 35,429,185 (GRCm39) I85N probably damaging Het
Duox2 C T 2: 122,122,739 (GRCm39) probably null Het
Ebi3 T A 17: 56,263,679 (GRCm39) Y197N probably damaging Het
Emc1 G A 4: 139,102,823 (GRCm39) R994Q probably benign Het
Ercc6 G T 14: 32,268,777 (GRCm39) M530I probably damaging Het
Evl T A 12: 108,619,255 (GRCm39) D70E probably damaging Het
Fbln2 A G 6: 91,242,757 (GRCm39) N819S probably damaging Het
Foxk2 A G 11: 121,176,363 (GRCm39) I170V probably benign Het
Gfm1 T C 3: 67,342,943 (GRCm39) V159A probably damaging Het
Gm10837 A G 14: 122,728,177 (GRCm39) T18A unknown Het
Gm12887 A T 4: 121,479,227 (GRCm39) V25E probably damaging Het
Hectd4 A G 5: 121,435,243 (GRCm39) H985R possibly damaging Het
Hsfy2 A G 1: 56,675,791 (GRCm39) Y249H possibly damaging Het
Hspg2 T C 4: 137,272,878 (GRCm39) V2639A probably damaging Het
Igf2r A G 17: 12,923,157 (GRCm39) probably null Het
Invs T A 4: 48,422,035 (GRCm39) I889N probably damaging Het
Kcnq1 A T 7: 142,736,857 (GRCm39) M209L probably benign Het
Klra7 A G 6: 130,206,957 (GRCm39) I48T possibly damaging Het
Krt26 CTAGTA CTA 11: 99,224,352 (GRCm39) probably benign Het
Lrif1 T A 3: 106,640,127 (GRCm39) V404D probably damaging Het
Lrriq1 T A 10: 103,063,034 (GRCm39) probably null Het
Lypd6 T A 2: 50,078,774 (GRCm39) I90N possibly damaging Het
Mbp A G 18: 82,602,247 (GRCm39) D174G probably damaging Het
Megf9 G T 4: 70,453,022 (GRCm39) P13Q probably damaging Het
Nherf2 C T 17: 24,860,693 (GRCm39) S150N possibly damaging Het
Nlrp6 T A 7: 140,503,006 (GRCm39) C371S probably damaging Het
Nosip T A 7: 44,726,733 (GRCm39) probably null Het
Nox3 G T 17: 3,720,153 (GRCm39) P344H probably damaging Het
Nup210l T C 3: 90,079,393 (GRCm39) V959A probably damaging Het
Or10d1 A G 9: 39,484,031 (GRCm39) Y175H possibly damaging Het
Or2b2b C A 13: 21,858,842 (GRCm39) V91L probably benign Het
Or2k2 T C 4: 58,785,384 (GRCm39) I113V probably benign Het
Or5b119 A G 19: 13,457,295 (GRCm39) I89T probably benign Het
Or5k8 T A 16: 58,644,440 (GRCm39) I211F probably damaging Het
Osbpl3 A C 6: 50,347,123 (GRCm39) S25A probably damaging Het
Otog G A 7: 45,895,707 (GRCm39) C107Y probably damaging Het
Pax7 G A 4: 139,511,802 (GRCm39) R260C probably damaging Het
Pbrm1 A T 14: 30,760,914 (GRCm39) I224F probably damaging Het
Pcdh1 T A 18: 38,325,278 (GRCm39) probably null Het
Pcnx1 T C 12: 82,027,709 (GRCm39) L1585P probably damaging Het
Pde4c C T 8: 71,200,599 (GRCm39) H362Y probably damaging Het
Pdlim2 C T 14: 70,402,228 (GRCm39) R296H probably damaging Het
Pgm1 A T 4: 99,818,675 (GRCm39) Q90L probably damaging Het
Phlpp1 A G 1: 106,271,235 (GRCm39) H814R probably benign Het
Pknox2 A T 9: 36,866,127 (GRCm39) M5K possibly damaging Het
Pole G A 5: 110,478,701 (GRCm39) probably null Het
Polr1b A G 2: 128,944,886 (GRCm39) I61V probably benign Het
Prelp T C 1: 133,842,495 (GRCm39) K217E probably damaging Het
Prkce C T 17: 86,782,974 (GRCm39) Q202* probably null Het
Psmd2 T G 16: 20,475,332 (GRCm39) M370R probably benign Het
Rimklb A T 6: 122,440,968 (GRCm39) H68Q probably damaging Het
Rnasel A G 1: 153,630,420 (GRCm39) D312G possibly damaging Het
Rxrg A T 1: 167,426,321 (GRCm39) M1L probably benign Het
Scrn1 A G 6: 54,499,826 (GRCm39) F220L possibly damaging Het
Scyl3 A G 1: 163,778,244 (GRCm39) S461G probably benign Het
Serpina1c T A 12: 103,861,282 (GRCm39) T411S probably benign Het
Serpinb6d C T 13: 33,855,364 (GRCm39) P346L probably benign Het
Shld2 A G 14: 33,989,760 (GRCm39) I382T probably benign Het
Spg21 G T 9: 65,372,618 (GRCm39) V17F probably damaging Het
Spink5 A T 18: 44,132,958 (GRCm39) M525L probably benign Het
Sun2 T C 15: 79,621,764 (GRCm39) T155A probably benign Het
Tchh T A 3: 93,354,087 (GRCm39) F1176I unknown Het
Tex15 T A 8: 34,066,682 (GRCm39) D2037E probably benign Het
Tfdp2 T C 9: 96,199,857 (GRCm39) C392R possibly damaging Het
Tmem30c T C 16: 57,097,143 (GRCm39) N139S probably benign Het
Tns2 C T 15: 102,021,568 (GRCm39) probably null Het
Trim66 T C 7: 109,075,046 (GRCm39) E405G probably damaging Het
Trpc4 T A 3: 54,187,415 (GRCm39) F456I probably benign Het
Tspo2 T C 17: 48,755,818 (GRCm39) D108G possibly damaging Het
Tyk2 A T 9: 21,032,850 (GRCm39) C304* probably null Het
Vgll4 A T 6: 114,839,756 (GRCm39) S185T probably benign Het
Vmn2r94 A C 17: 18,464,732 (GRCm39) S519R probably benign Het
Vmn2r96 T G 17: 18,818,183 (GRCm39) S587A probably benign Het
Vps4b C A 1: 106,706,712 (GRCm39) A287S possibly damaging Het
Yeats2 C T 16: 20,048,314 (GRCm39) P1332S probably benign Het
Zfp462 T G 4: 55,010,010 (GRCm39) S659A possibly damaging Het
Zfp507 C T 7: 35,493,150 (GRCm39) R631Q probably damaging Het
Zfp764l1 A C 7: 126,990,660 (GRCm39) D442E probably benign Het
Zswim5 G T 4: 116,734,896 (GRCm39) E80D unknown Het
Other mutations in Myo15b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Myo15b APN 11 115,782,742 (GRCm39) missense possibly damaging 0.69
IGL01409:Myo15b APN 11 115,760,330 (GRCm39) nonsense probably null
IGL01539:Myo15b APN 11 115,754,299 (GRCm39) missense probably benign 0.43
IGL01895:Myo15b APN 11 115,774,324 (GRCm39) missense possibly damaging 0.77
IGL02254:Myo15b APN 11 115,777,109 (GRCm39) missense probably damaging 1.00
IGL02343:Myo15b APN 11 115,764,226 (GRCm39) unclassified probably benign
IGL02349:Myo15b APN 11 115,753,931 (GRCm39) splice site probably benign
IGL02368:Myo15b APN 11 115,767,828 (GRCm39) missense probably benign 0.13
IGL02576:Myo15b APN 11 115,780,879 (GRCm39) missense probably null 0.97
IGL02650:Myo15b APN 11 115,777,337 (GRCm39) critical splice donor site probably null
IGL02661:Myo15b APN 11 115,774,895 (GRCm39) missense probably benign 0.01
IGL02716:Myo15b APN 11 115,774,535 (GRCm39) missense probably benign 0.06
IGL02733:Myo15b APN 11 115,775,076 (GRCm39) missense probably benign 0.00
IGL02951:Myo15b APN 11 115,772,127 (GRCm39) missense probably damaging 1.00
IGL03017:Myo15b APN 11 115,778,743 (GRCm39) missense possibly damaging 0.91
IGL03029:Myo15b APN 11 115,762,469 (GRCm39) missense probably benign 0.08
ANU74:Myo15b UTSW 11 115,769,239 (GRCm39) missense probably damaging 1.00
R0092:Myo15b UTSW 11 115,753,812 (GRCm39) missense possibly damaging 0.90
R0255:Myo15b UTSW 11 115,777,109 (GRCm39) missense probably damaging 1.00
R0325:Myo15b UTSW 11 115,775,091 (GRCm39) missense probably damaging 1.00
R0614:Myo15b UTSW 11 115,773,739 (GRCm39) missense probably damaging 1.00
R0652:Myo15b UTSW 11 115,755,468 (GRCm39) missense probably benign 0.07
R0711:Myo15b UTSW 11 115,774,664 (GRCm39) missense probably damaging 1.00
R0815:Myo15b UTSW 11 115,757,162 (GRCm39) splice site probably benign
R0961:Myo15b UTSW 11 115,773,280 (GRCm39) missense probably benign 0.15
R1066:Myo15b UTSW 11 115,770,577 (GRCm39) missense probably benign 0.03
R1221:Myo15b UTSW 11 115,777,546 (GRCm39) missense possibly damaging 0.75
R1240:Myo15b UTSW 11 115,771,327 (GRCm39) missense possibly damaging 0.70
R1275:Myo15b UTSW 11 115,774,318 (GRCm39) small deletion probably benign
R1313:Myo15b UTSW 11 115,775,955 (GRCm39) missense probably damaging 1.00
R1313:Myo15b UTSW 11 115,775,955 (GRCm39) missense probably damaging 1.00
R1317:Myo15b UTSW 11 115,774,460 (GRCm39) missense probably null 0.14
R1491:Myo15b UTSW 11 115,777,683 (GRCm39) splice site probably null
R1552:Myo15b UTSW 11 115,757,461 (GRCm39) missense probably benign 0.08
R1731:Myo15b UTSW 11 115,782,386 (GRCm39) missense possibly damaging 0.57
R1800:Myo15b UTSW 11 115,771,335 (GRCm39) critical splice donor site probably null
R1888:Myo15b UTSW 11 115,777,899 (GRCm39) missense probably damaging 1.00
R1888:Myo15b UTSW 11 115,777,899 (GRCm39) missense probably damaging 1.00
R1894:Myo15b UTSW 11 115,777,899 (GRCm39) missense probably damaging 1.00
R1917:Myo15b UTSW 11 115,773,080 (GRCm39) missense possibly damaging 0.51
R1934:Myo15b UTSW 11 115,754,310 (GRCm39) missense probably benign 0.30
R1939:Myo15b UTSW 11 115,778,529 (GRCm39) missense probably benign 0.00
R1945:Myo15b UTSW 11 115,769,224 (GRCm39) missense probably damaging 1.00
R1986:Myo15b UTSW 11 115,773,701 (GRCm39) missense probably benign 0.31
R2130:Myo15b UTSW 11 115,762,469 (GRCm39) missense probably benign 0.08
R2138:Myo15b UTSW 11 115,774,633 (GRCm39) missense probably benign 0.00
R2176:Myo15b UTSW 11 115,757,398 (GRCm39) missense probably damaging 1.00
R2415:Myo15b UTSW 11 115,770,390 (GRCm39) missense probably benign 0.00
R2483:Myo15b UTSW 11 115,755,565 (GRCm39) missense probably benign 0.04
R3620:Myo15b UTSW 11 115,762,013 (GRCm39) missense possibly damaging 0.46
R3716:Myo15b UTSW 11 115,754,239 (GRCm39) missense probably benign 0.01
R4013:Myo15b UTSW 11 115,762,282 (GRCm39) nonsense probably null
R4021:Myo15b UTSW 11 115,764,331 (GRCm39) missense probably benign 0.07
R4119:Myo15b UTSW 11 115,764,318 (GRCm39) missense probably benign 0.07
R4120:Myo15b UTSW 11 115,764,318 (GRCm39) missense probably benign 0.07
R4499:Myo15b UTSW 11 115,781,778 (GRCm39) missense probably benign 0.00
R4653:Myo15b UTSW 11 115,770,813 (GRCm39) critical splice donor site probably null
R4655:Myo15b UTSW 11 115,781,523 (GRCm39) missense probably damaging 1.00
R4700:Myo15b UTSW 11 115,752,761 (GRCm39) missense possibly damaging 0.55
R4702:Myo15b UTSW 11 115,774,834 (GRCm39) missense probably benign 0.01
R4777:Myo15b UTSW 11 115,770,478 (GRCm39) missense probably damaging 0.99
R4833:Myo15b UTSW 11 115,778,428 (GRCm39) missense possibly damaging 0.51
R5083:Myo15b UTSW 11 115,757,482 (GRCm39) missense probably benign 0.01
R5121:Myo15b UTSW 11 115,776,880 (GRCm39) missense probably damaging 1.00
R5146:Myo15b UTSW 11 115,782,024 (GRCm39) missense probably benign 0.00
R5535:Myo15b UTSW 11 115,772,127 (GRCm39) missense probably damaging 1.00
R5647:Myo15b UTSW 11 115,762,337 (GRCm39) missense probably damaging 0.99
R5849:Myo15b UTSW 11 115,772,759 (GRCm39) missense probably damaging 1.00
R5882:Myo15b UTSW 11 115,760,422 (GRCm39) missense probably damaging 1.00
R5956:Myo15b UTSW 11 115,764,583 (GRCm39) missense probably benign 0.34
R6273:Myo15b UTSW 11 115,753,625 (GRCm39) missense possibly damaging 0.63
R6302:Myo15b UTSW 11 115,777,065 (GRCm39) missense possibly damaging 0.88
R6318:Myo15b UTSW 11 115,781,657 (GRCm39) missense probably damaging 1.00
R6462:Myo15b UTSW 11 115,750,268 (GRCm39) missense probably benign 0.01
R6792:Myo15b UTSW 11 115,775,923 (GRCm39) missense probably damaging 1.00
R6963:Myo15b UTSW 11 115,781,540 (GRCm39) splice site probably null
R7015:Myo15b UTSW 11 115,762,670 (GRCm39) missense
R7020:Myo15b UTSW 11 115,757,493 (GRCm39) nonsense probably null
R7096:Myo15b UTSW 11 115,782,324 (GRCm39) splice site probably null
R7219:Myo15b UTSW 11 115,767,921 (GRCm39) critical splice donor site probably null
R7400:Myo15b UTSW 11 115,750,939 (GRCm39) missense
R7413:Myo15b UTSW 11 115,768,970 (GRCm39) missense
R7483:Myo15b UTSW 11 115,749,570 (GRCm39) missense
R7523:Myo15b UTSW 11 115,781,684 (GRCm39) missense unknown
R7737:Myo15b UTSW 11 115,778,749 (GRCm39) missense unknown
R7784:Myo15b UTSW 11 115,752,166 (GRCm39) missense
R7842:Myo15b UTSW 11 115,762,321 (GRCm39) missense
R7921:Myo15b UTSW 11 115,778,004 (GRCm39) nonsense probably null
R8065:Myo15b UTSW 11 115,778,769 (GRCm39) critical splice donor site probably null
R8183:Myo15b UTSW 11 115,773,843 (GRCm39) splice site probably null
R8193:Myo15b UTSW 11 115,775,973 (GRCm39) missense probably damaging 1.00
R8237:Myo15b UTSW 11 115,767,827 (GRCm39) missense
R8430:Myo15b UTSW 11 115,773,049 (GRCm39) missense probably benign 0.02
R8482:Myo15b UTSW 11 115,774,083 (GRCm39) nonsense probably null
R8515:Myo15b UTSW 11 115,749,610 (GRCm39) missense
R8798:Myo15b UTSW 11 115,754,232 (GRCm39) missense
R8937:Myo15b UTSW 11 115,773,127 (GRCm39) missense probably benign 0.00
R8975:Myo15b UTSW 11 115,781,780 (GRCm39) missense unknown
R9045:Myo15b UTSW 11 115,783,178 (GRCm39) makesense probably null
R9117:Myo15b UTSW 11 115,778,743 (GRCm39) missense possibly damaging 0.91
R9185:Myo15b UTSW 11 115,771,255 (GRCm39) missense unknown
R9226:Myo15b UTSW 11 115,750,924 (GRCm39) missense
R9302:Myo15b UTSW 11 115,776,238 (GRCm39) missense possibly damaging 0.83
R9318:Myo15b UTSW 11 115,775,965 (GRCm39) missense probably benign 0.26
R9336:Myo15b UTSW 11 115,771,064 (GRCm39) missense
R9337:Myo15b UTSW 11 115,749,861 (GRCm39) missense
R9338:Myo15b UTSW 11 115,762,238 (GRCm39) missense
R9498:Myo15b UTSW 11 115,770,784 (GRCm39) missense
R9500:Myo15b UTSW 11 115,777,466 (GRCm39) missense probably damaging 0.98
R9602:Myo15b UTSW 11 115,769,269 (GRCm39) critical splice donor site probably null
R9642:Myo15b UTSW 11 115,772,335 (GRCm39) missense possibly damaging 0.67
X0020:Myo15b UTSW 11 115,762,625 (GRCm39) critical splice acceptor site probably null
Z1176:Myo15b UTSW 11 115,778,751 (GRCm39) missense unknown
Z1176:Myo15b UTSW 11 115,774,278 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TGCGGTCTTCAGGAAGGAAC -3'
(R):5'- GGCTCAGTGGTTAAGAGAGC -3'

Sequencing Primer
(F):5'- TCTTCAGGAAGGAACGGGGTG -3'
(R):5'- TAAGACACCTGCTGCTGAGTCTG -3'
Posted On 2014-06-23