Incidental Mutation 'R1843:Apob'
ID 207458
Institutional Source Beutler Lab
Gene Symbol Apob
Ensembl Gene ENSMUSG00000020609
Gene Name apolipoprotein B
Synonyms apob-100, apob-48
MMRRC Submission 039868-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.851) question?
Stock # R1843 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 8027648-8066835 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 8057602 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 2028 (F2028S)
Ref Sequence ENSEMBL: ENSMUSP00000036044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037520] [ENSMUST00000037811] [ENSMUST00000171239]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000037520
AA Change: F1995S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000035761
Gene: ENSMUSG00000020609
AA Change: F1995S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LPD_N 33 585 6.03e-94 SMART
DUF1943 619 932 7.88e-97 SMART
Pfam:DUF1081 945 1059 9.4e-32 PFAM
low complexity region 1100 1109 N/A INTRINSIC
Blast:LPD_N 1249 1311 9e-22 BLAST
low complexity region 1632 1644 N/A INTRINSIC
internal_repeat_1 1882 2038 6.61e-9 PROSPERO
SCOP:d1gw5a_ 2105 2577 9e-5 SMART
internal_repeat_1 2973 3150 6.61e-9 PROSPERO
low complexity region 3561 3580 N/A INTRINSIC
low complexity region 3928 3936 N/A INTRINSIC
Pfam:ApoB100_C 4401 4456 5.6e-34 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000037811
AA Change: F2028S

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000036044
Gene: ENSMUSG00000020609
AA Change: F2028S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LPD_N 46 598 6.03e-94 SMART
DUF1943 632 945 7.88e-97 SMART
Pfam:DUF1081 960 1070 6.3e-39 PFAM
low complexity region 1113 1122 N/A INTRINSIC
Blast:LPD_N 1282 1344 1e-21 BLAST
low complexity region 1665 1677 N/A INTRINSIC
internal_repeat_1 1915 2071 6.6e-9 PROSPERO
SCOP:d1gw5a_ 2138 2610 9e-5 SMART
internal_repeat_1 3006 3183 6.6e-9 PROSPERO
low complexity region 3594 3613 N/A INTRINSIC
low complexity region 3961 3969 N/A INTRINSIC
Pfam:ApoB100_C 4434 4490 1.6e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171239
SMART Domains Protein: ENSMUSP00000129496
Gene: ENSMUSG00000020609

DomainStartEndE-ValueType
low complexity region 348 356 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene product is the main apolipoprotein of chylomicrons and low density lipoproteins. It occurs in plasma as two main isoforms, apoB-48 and apoB-100. Unlike the apoB-48 and apoB-100 structural equivalents in human, which are synthesized exclusively in the gut and liver, respectively, the mouse apoB-48 isoform is also found in mouse liver. The intestinal and the hepatic forms of apoB are encoded by a single gene from a single, very long mRNA. The two isoforms share a common N-terminal sequence. The shorter apoB-48 protein is produced after RNA editing of the apoB-100 transcript at residue 2179 (CAA->UAA), resulting in the creation of a stop codon, and early translation termination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants usually die by midgestation and longer survivors exhibit exencephaly. Heterozygotes show reduced plasma cholesterol and apolipoprotein levels. Single isoform B100 and B48 null mutants are viable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik C T 8: 106,435,606 (GRCm39) T88M probably damaging Het
9430038I01Rik A G 7: 136,978,795 (GRCm39) probably benign Het
Adgra3 A C 5: 50,118,834 (GRCm39) S905A probably damaging Het
Adgrv1 A G 13: 81,692,652 (GRCm39) Y1618H probably damaging Het
Anapc15-ps T C 10: 95,509,176 (GRCm39) T26A probably benign Het
Ankrd13d T C 19: 4,321,623 (GRCm39) K360E probably damaging Het
Anks1b T A 10: 90,348,751 (GRCm39) probably null Het
Arap3 G A 18: 38,108,636 (GRCm39) R1265W probably damaging Het
Arhgef37 A G 18: 61,651,121 (GRCm39) Y135H probably damaging Het
Armh3 A C 19: 45,963,691 (GRCm39) S42R probably benign Het
Atp1a1 T C 3: 101,489,333 (GRCm39) T760A probably benign Het
Cdc42bpb T A 12: 111,289,255 (GRCm39) M497L probably benign Het
Ces5a C T 8: 94,240,859 (GRCm39) V413M probably damaging Het
Chd5 A T 4: 152,470,263 (GRCm39) Y1903F probably damaging Het
Chd9 T A 8: 91,737,422 (GRCm39) N1500K probably benign Het
Chmp7 G T 14: 69,957,248 (GRCm39) D303E probably benign Het
Chrnb4 A T 9: 54,942,102 (GRCm39) Y391N possibly damaging Het
Crtc1 T C 8: 70,840,802 (GRCm39) T475A probably benign Het
Cyp2c69 A G 19: 39,865,972 (GRCm39) I207T probably benign Het
Dcp1a A G 14: 30,240,940 (GRCm39) E250G probably damaging Het
Ddx20 T C 3: 105,586,398 (GRCm39) Q649R probably benign Het
Defb12 T A 8: 19,162,754 (GRCm39) K59N probably damaging Het
Dpy19l3 A T 7: 35,429,185 (GRCm39) I85N probably damaging Het
Duox2 C T 2: 122,122,739 (GRCm39) probably null Het
Ebi3 T A 17: 56,263,679 (GRCm39) Y197N probably damaging Het
Emc1 G A 4: 139,102,823 (GRCm39) R994Q probably benign Het
Ercc6 G T 14: 32,268,777 (GRCm39) M530I probably damaging Het
Evl T A 12: 108,619,255 (GRCm39) D70E probably damaging Het
Fbln2 A G 6: 91,242,757 (GRCm39) N819S probably damaging Het
Foxk2 A G 11: 121,176,363 (GRCm39) I170V probably benign Het
Gfm1 T C 3: 67,342,943 (GRCm39) V159A probably damaging Het
Gm10837 A G 14: 122,728,177 (GRCm39) T18A unknown Het
Gm12887 A T 4: 121,479,227 (GRCm39) V25E probably damaging Het
Hectd4 A G 5: 121,435,243 (GRCm39) H985R possibly damaging Het
Hsfy2 A G 1: 56,675,791 (GRCm39) Y249H possibly damaging Het
Hspg2 T C 4: 137,272,878 (GRCm39) V2639A probably damaging Het
Igf2r A G 17: 12,923,157 (GRCm39) probably null Het
Invs T A 4: 48,422,035 (GRCm39) I889N probably damaging Het
Kcnq1 A T 7: 142,736,857 (GRCm39) M209L probably benign Het
Klra7 A G 6: 130,206,957 (GRCm39) I48T possibly damaging Het
Krt26 CTAGTA CTA 11: 99,224,352 (GRCm39) probably benign Het
Lrif1 T A 3: 106,640,127 (GRCm39) V404D probably damaging Het
Lrriq1 T A 10: 103,063,034 (GRCm39) probably null Het
Lypd6 T A 2: 50,078,774 (GRCm39) I90N possibly damaging Het
Mbp A G 18: 82,602,247 (GRCm39) D174G probably damaging Het
Megf9 G T 4: 70,453,022 (GRCm39) P13Q probably damaging Het
Myo15b A T 11: 115,760,412 (GRCm39) T1155S probably benign Het
Nherf2 C T 17: 24,860,693 (GRCm39) S150N possibly damaging Het
Nlrp6 T A 7: 140,503,006 (GRCm39) C371S probably damaging Het
Nosip T A 7: 44,726,733 (GRCm39) probably null Het
Nox3 G T 17: 3,720,153 (GRCm39) P344H probably damaging Het
Nup210l T C 3: 90,079,393 (GRCm39) V959A probably damaging Het
Or10d1 A G 9: 39,484,031 (GRCm39) Y175H possibly damaging Het
Or2b2b C A 13: 21,858,842 (GRCm39) V91L probably benign Het
Or2k2 T C 4: 58,785,384 (GRCm39) I113V probably benign Het
Or5b119 A G 19: 13,457,295 (GRCm39) I89T probably benign Het
Or5k8 T A 16: 58,644,440 (GRCm39) I211F probably damaging Het
Osbpl3 A C 6: 50,347,123 (GRCm39) S25A probably damaging Het
Otog G A 7: 45,895,707 (GRCm39) C107Y probably damaging Het
Pax7 G A 4: 139,511,802 (GRCm39) R260C probably damaging Het
Pbrm1 A T 14: 30,760,914 (GRCm39) I224F probably damaging Het
Pcdh1 T A 18: 38,325,278 (GRCm39) probably null Het
Pcnx1 T C 12: 82,027,709 (GRCm39) L1585P probably damaging Het
Pde4c C T 8: 71,200,599 (GRCm39) H362Y probably damaging Het
Pdlim2 C T 14: 70,402,228 (GRCm39) R296H probably damaging Het
Pgm1 A T 4: 99,818,675 (GRCm39) Q90L probably damaging Het
Phlpp1 A G 1: 106,271,235 (GRCm39) H814R probably benign Het
Pknox2 A T 9: 36,866,127 (GRCm39) M5K possibly damaging Het
Pole G A 5: 110,478,701 (GRCm39) probably null Het
Polr1b A G 2: 128,944,886 (GRCm39) I61V probably benign Het
Prelp T C 1: 133,842,495 (GRCm39) K217E probably damaging Het
Prkce C T 17: 86,782,974 (GRCm39) Q202* probably null Het
Psmd2 T G 16: 20,475,332 (GRCm39) M370R probably benign Het
Rimklb A T 6: 122,440,968 (GRCm39) H68Q probably damaging Het
Rnasel A G 1: 153,630,420 (GRCm39) D312G possibly damaging Het
Rxrg A T 1: 167,426,321 (GRCm39) M1L probably benign Het
Scrn1 A G 6: 54,499,826 (GRCm39) F220L possibly damaging Het
Scyl3 A G 1: 163,778,244 (GRCm39) S461G probably benign Het
Serpina1c T A 12: 103,861,282 (GRCm39) T411S probably benign Het
Serpinb6d C T 13: 33,855,364 (GRCm39) P346L probably benign Het
Shld2 A G 14: 33,989,760 (GRCm39) I382T probably benign Het
Spg21 G T 9: 65,372,618 (GRCm39) V17F probably damaging Het
Spink5 A T 18: 44,132,958 (GRCm39) M525L probably benign Het
Sun2 T C 15: 79,621,764 (GRCm39) T155A probably benign Het
Tchh T A 3: 93,354,087 (GRCm39) F1176I unknown Het
Tex15 T A 8: 34,066,682 (GRCm39) D2037E probably benign Het
Tfdp2 T C 9: 96,199,857 (GRCm39) C392R possibly damaging Het
Tmem30c T C 16: 57,097,143 (GRCm39) N139S probably benign Het
Tns2 C T 15: 102,021,568 (GRCm39) probably null Het
Trim66 T C 7: 109,075,046 (GRCm39) E405G probably damaging Het
Trpc4 T A 3: 54,187,415 (GRCm39) F456I probably benign Het
Tspo2 T C 17: 48,755,818 (GRCm39) D108G possibly damaging Het
Tyk2 A T 9: 21,032,850 (GRCm39) C304* probably null Het
Vgll4 A T 6: 114,839,756 (GRCm39) S185T probably benign Het
Vmn2r94 A C 17: 18,464,732 (GRCm39) S519R probably benign Het
Vmn2r96 T G 17: 18,818,183 (GRCm39) S587A probably benign Het
Vps4b C A 1: 106,706,712 (GRCm39) A287S possibly damaging Het
Yeats2 C T 16: 20,048,314 (GRCm39) P1332S probably benign Het
Zfp462 T G 4: 55,010,010 (GRCm39) S659A possibly damaging Het
Zfp507 C T 7: 35,493,150 (GRCm39) R631Q probably damaging Het
Zfp764l1 A C 7: 126,990,660 (GRCm39) D442E probably benign Het
Zswim5 G T 4: 116,734,896 (GRCm39) E80D unknown Het
Other mutations in Apob
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Apob APN 12 8,043,065 (GRCm39) splice site probably benign
IGL00421:Apob APN 12 8,060,197 (GRCm39) missense probably damaging 0.99
IGL00658:Apob APN 12 8,059,471 (GRCm39) missense probably benign 0.08
IGL00768:Apob APN 12 8,052,107 (GRCm39) missense probably damaging 1.00
IGL00833:Apob APN 12 8,060,101 (GRCm39) missense probably benign 0.14
IGL00926:Apob APN 12 8,065,421 (GRCm39) missense probably benign 0.01
IGL01065:Apob APN 12 8,053,299 (GRCm39) missense probably damaging 0.99
IGL01313:Apob APN 12 8,050,898 (GRCm39) missense probably damaging 1.00
IGL01419:Apob APN 12 8,052,251 (GRCm39) missense probably damaging 0.99
IGL01461:Apob APN 12 8,051,884 (GRCm39) missense probably benign 0.13
IGL02002:Apob APN 12 8,044,822 (GRCm39) missense probably benign 0.03
IGL02031:Apob APN 12 8,065,222 (GRCm39) missense probably benign
IGL02102:Apob APN 12 8,039,407 (GRCm39) missense possibly damaging 0.94
IGL02115:Apob APN 12 8,042,923 (GRCm39) missense probably benign 0.06
IGL02513:Apob APN 12 8,042,979 (GRCm39) missense probably benign 0.01
IGL02967:Apob APN 12 8,065,366 (GRCm39) nonsense probably null
IGL03005:Apob APN 12 8,043,059 (GRCm39) splice site probably benign
IGL03011:Apob APN 12 8,047,883 (GRCm39) missense probably damaging 1.00
IGL03116:Apob APN 12 8,066,350 (GRCm39) missense probably damaging 0.98
IGL03215:Apob APN 12 8,063,818 (GRCm39) missense possibly damaging 0.92
IGL03227:Apob APN 12 8,066,089 (GRCm39) missense probably benign 0.04
Aesthete UTSW 12 8,060,080 (GRCm39) nonsense probably null
Essence UTSW 12 8,057,769 (GRCm39) nonsense probably null
Ethos UTSW 12 8,040,394 (GRCm39) missense probably null 1.00
IGL02835:Apob UTSW 12 8,065,097 (GRCm39) missense possibly damaging 0.86
IGL02837:Apob UTSW 12 8,055,102 (GRCm39) missense probably damaging 1.00
R0071:Apob UTSW 12 8,052,111 (GRCm39) missense probably damaging 0.98
R0071:Apob UTSW 12 8,052,111 (GRCm39) missense probably damaging 0.98
R0116:Apob UTSW 12 8,039,113 (GRCm39) unclassified probably benign
R0180:Apob UTSW 12 8,058,285 (GRCm39) nonsense probably null
R0288:Apob UTSW 12 8,040,779 (GRCm39) nonsense probably null
R0295:Apob UTSW 12 8,052,181 (GRCm39) nonsense probably null
R0305:Apob UTSW 12 8,062,210 (GRCm39) missense probably damaging 1.00
R0312:Apob UTSW 12 8,059,034 (GRCm39) missense probably benign
R0324:Apob UTSW 12 8,060,521 (GRCm39) missense probably benign 0.41
R0326:Apob UTSW 12 8,040,307 (GRCm39) missense probably damaging 1.00
R0363:Apob UTSW 12 8,060,136 (GRCm39) missense probably damaging 1.00
R0390:Apob UTSW 12 8,038,678 (GRCm39) missense probably damaging 0.99
R0462:Apob UTSW 12 8,050,896 (GRCm39) missense probably damaging 1.00
R0471:Apob UTSW 12 8,040,406 (GRCm39) missense probably damaging 1.00
R0532:Apob UTSW 12 8,066,188 (GRCm39) missense possibly damaging 0.48
R0548:Apob UTSW 12 8,056,282 (GRCm39) missense probably damaging 1.00
R0560:Apob UTSW 12 8,055,101 (GRCm39) missense probably damaging 1.00
R0595:Apob UTSW 12 8,058,369 (GRCm39) missense probably benign 0.01
R0600:Apob UTSW 12 8,056,440 (GRCm39) missense probably damaging 1.00
R0626:Apob UTSW 12 8,066,193 (GRCm39) missense probably benign 0.45
R0685:Apob UTSW 12 8,060,742 (GRCm39) missense probably benign
R0765:Apob UTSW 12 8,066,518 (GRCm39) missense probably benign
R0790:Apob UTSW 12 8,060,245 (GRCm39) missense probably damaging 1.00
R0918:Apob UTSW 12 8,033,941 (GRCm39) missense probably benign 0.10
R0962:Apob UTSW 12 8,039,191 (GRCm39) missense probably damaging 0.98
R1055:Apob UTSW 12 8,044,963 (GRCm39) missense probably damaging 1.00
R1077:Apob UTSW 12 8,056,017 (GRCm39) missense probably benign
R1143:Apob UTSW 12 8,062,354 (GRCm39) missense probably benign 0.26
R1163:Apob UTSW 12 8,061,654 (GRCm39) missense probably damaging 1.00
R1266:Apob UTSW 12 8,056,093 (GRCm39) missense probably benign 0.37
R1434:Apob UTSW 12 8,059,715 (GRCm39) missense probably damaging 1.00
R1442:Apob UTSW 12 8,036,165 (GRCm39) missense probably benign 0.31
R1445:Apob UTSW 12 8,066,084 (GRCm39) missense possibly damaging 0.48
R1459:Apob UTSW 12 8,061,937 (GRCm39) missense possibly damaging 0.92
R1459:Apob UTSW 12 8,056,047 (GRCm39) missense probably benign
R1465:Apob UTSW 12 8,061,421 (GRCm39) missense possibly damaging 0.91
R1465:Apob UTSW 12 8,061,421 (GRCm39) missense possibly damaging 0.91
R1508:Apob UTSW 12 8,061,481 (GRCm39) missense possibly damaging 0.92
R1518:Apob UTSW 12 8,039,207 (GRCm39) missense probably benign 0.01
R1531:Apob UTSW 12 8,047,880 (GRCm39) missense possibly damaging 0.65
R1547:Apob UTSW 12 8,053,368 (GRCm39) missense probably benign 0.08
R1574:Apob UTSW 12 8,040,839 (GRCm39) missense possibly damaging 0.51
R1574:Apob UTSW 12 8,040,839 (GRCm39) missense possibly damaging 0.51
R1682:Apob UTSW 12 8,062,365 (GRCm39) missense probably benign 0.00
R1709:Apob UTSW 12 8,059,306 (GRCm39) missense probably damaging 0.98
R1718:Apob UTSW 12 8,066,087 (GRCm39) missense probably benign 0.02
R1752:Apob UTSW 12 8,038,766 (GRCm39) missense probably benign 0.01
R1781:Apob UTSW 12 8,059,603 (GRCm39) missense possibly damaging 0.96
R1818:Apob UTSW 12 8,063,064 (GRCm39) missense possibly damaging 0.93
R1818:Apob UTSW 12 8,056,834 (GRCm39) missense probably damaging 0.98
R1842:Apob UTSW 12 8,061,559 (GRCm39) missense probably damaging 1.00
R1853:Apob UTSW 12 8,060,928 (GRCm39) nonsense probably null
R1990:Apob UTSW 12 8,051,039 (GRCm39) missense probably damaging 1.00
R2016:Apob UTSW 12 8,057,751 (GRCm39) missense possibly damaging 0.48
R2017:Apob UTSW 12 8,057,751 (GRCm39) missense possibly damaging 0.48
R2023:Apob UTSW 12 8,061,090 (GRCm39) missense probably benign 0.01
R2037:Apob UTSW 12 8,057,488 (GRCm39) missense probably benign 0.37
R2054:Apob UTSW 12 8,063,134 (GRCm39) missense probably damaging 1.00
R2057:Apob UTSW 12 8,052,164 (GRCm39) nonsense probably null
R2085:Apob UTSW 12 8,062,240 (GRCm39) missense probably damaging 1.00
R2159:Apob UTSW 12 8,060,081 (GRCm39) missense probably benign 0.12
R2209:Apob UTSW 12 8,057,752 (GRCm39) missense probably benign 0.28
R2249:Apob UTSW 12 8,057,499 (GRCm39) missense probably damaging 1.00
R2254:Apob UTSW 12 8,061,256 (GRCm39) missense possibly damaging 0.92
R2265:Apob UTSW 12 8,065,475 (GRCm39) missense possibly damaging 0.74
R2266:Apob UTSW 12 8,065,475 (GRCm39) missense possibly damaging 0.74
R2267:Apob UTSW 12 8,065,475 (GRCm39) missense possibly damaging 0.74
R2268:Apob UTSW 12 8,065,475 (GRCm39) missense possibly damaging 0.74
R2296:Apob UTSW 12 8,044,879 (GRCm39) missense probably damaging 0.97
R2897:Apob UTSW 12 8,060,356 (GRCm39) missense probably damaging 1.00
R3431:Apob UTSW 12 8,060,778 (GRCm39) missense probably damaging 1.00
R3723:Apob UTSW 12 8,061,763 (GRCm39) missense possibly damaging 0.46
R3723:Apob UTSW 12 8,056,327 (GRCm39) missense probably damaging 1.00
R3899:Apob UTSW 12 8,065,849 (GRCm39) missense possibly damaging 0.87
R4020:Apob UTSW 12 8,044,914 (GRCm39) nonsense probably null
R4050:Apob UTSW 12 8,065,390 (GRCm39) missense probably benign 0.02
R4351:Apob UTSW 12 8,043,054 (GRCm39) missense probably benign 0.03
R4365:Apob UTSW 12 8,066,083 (GRCm39) missense possibly damaging 0.95
R4366:Apob UTSW 12 8,066,083 (GRCm39) missense possibly damaging 0.95
R4456:Apob UTSW 12 8,065,445 (GRCm39) missense probably damaging 1.00
R4458:Apob UTSW 12 8,065,445 (GRCm39) missense probably damaging 1.00
R4600:Apob UTSW 12 8,058,568 (GRCm39) missense probably damaging 1.00
R4611:Apob UTSW 12 8,061,331 (GRCm39) missense probably damaging 1.00
R4646:Apob UTSW 12 8,062,759 (GRCm39) missense probably benign 0.21
R4678:Apob UTSW 12 8,045,585 (GRCm39) missense probably damaging 1.00
R4685:Apob UTSW 12 8,056,456 (GRCm39) missense probably benign 0.00
R4707:Apob UTSW 12 8,056,205 (GRCm39) missense probably damaging 0.96
R4726:Apob UTSW 12 8,040,267 (GRCm39) missense probably damaging 0.98
R4792:Apob UTSW 12 8,058,051 (GRCm39) missense probably benign 0.26
R4822:Apob UTSW 12 8,065,741 (GRCm39) missense probably benign 0.04
R4834:Apob UTSW 12 8,064,101 (GRCm39) missense possibly damaging 0.49
R4835:Apob UTSW 12 8,065,391 (GRCm39) missense possibly damaging 0.56
R4887:Apob UTSW 12 8,063,099 (GRCm39) missense probably damaging 1.00
R4910:Apob UTSW 12 8,057,848 (GRCm39) missense probably damaging 1.00
R5072:Apob UTSW 12 8,058,714 (GRCm39) missense probably benign 0.00
R5073:Apob UTSW 12 8,055,219 (GRCm39) critical splice donor site probably null
R5074:Apob UTSW 12 8,055,219 (GRCm39) critical splice donor site probably null
R5101:Apob UTSW 12 8,061,934 (GRCm39) missense probably benign 0.09
R5123:Apob UTSW 12 8,057,630 (GRCm39) splice site probably null
R5133:Apob UTSW 12 8,058,898 (GRCm39) missense probably damaging 0.99
R5135:Apob UTSW 12 8,060,086 (GRCm39) missense probably damaging 1.00
R5137:Apob UTSW 12 8,061,384 (GRCm39) missense possibly damaging 0.63
R5160:Apob UTSW 12 8,062,126 (GRCm39) missense possibly damaging 0.90
R5173:Apob UTSW 12 8,058,238 (GRCm39) missense probably benign 0.00
R5202:Apob UTSW 12 8,063,737 (GRCm39) missense probably damaging 0.98
R5229:Apob UTSW 12 8,027,806 (GRCm39) missense probably benign
R5292:Apob UTSW 12 8,055,912 (GRCm39) missense probably benign 0.01
R5378:Apob UTSW 12 8,061,865 (GRCm39) missense probably damaging 0.99
R5494:Apob UTSW 12 8,061,762 (GRCm39) missense probably damaging 0.99
R5517:Apob UTSW 12 8,040,906 (GRCm39) missense probably damaging 1.00
R5576:Apob UTSW 12 8,048,662 (GRCm39) missense probably damaging 1.00
R5582:Apob UTSW 12 8,060,788 (GRCm39) missense probably damaging 1.00
R5629:Apob UTSW 12 8,057,847 (GRCm39) missense probably damaging 1.00
R5678:Apob UTSW 12 8,041,494 (GRCm39) missense possibly damaging 0.92
R5732:Apob UTSW 12 8,060,353 (GRCm39) missense probably benign 0.15
R5734:Apob UTSW 12 8,038,781 (GRCm39) missense probably damaging 1.00
R5742:Apob UTSW 12 8,057,191 (GRCm39) missense probably damaging 1.00
R5751:Apob UTSW 12 8,062,619 (GRCm39) nonsense probably null
R5776:Apob UTSW 12 8,056,149 (GRCm39) missense possibly damaging 0.57
R5778:Apob UTSW 12 8,065,074 (GRCm39) missense probably benign 0.45
R5783:Apob UTSW 12 8,051,022 (GRCm39) missense probably damaging 1.00
R5786:Apob UTSW 12 8,065,304 (GRCm39) missense possibly damaging 0.48
R5837:Apob UTSW 12 8,053,277 (GRCm39) missense probably benign 0.04
R5857:Apob UTSW 12 8,065,397 (GRCm39) missense probably benign 0.00
R6029:Apob UTSW 12 8,066,243 (GRCm39) missense probably damaging 0.99
R6032:Apob UTSW 12 8,045,513 (GRCm39) missense probably benign 0.02
R6032:Apob UTSW 12 8,045,513 (GRCm39) missense probably benign 0.02
R6086:Apob UTSW 12 8,065,164 (GRCm39) missense probably benign
R6110:Apob UTSW 12 8,061,883 (GRCm39) missense probably damaging 1.00
R6131:Apob UTSW 12 8,065,874 (GRCm39) missense probably benign 0.17
R6157:Apob UTSW 12 8,056,077 (GRCm39) missense probably benign
R6179:Apob UTSW 12 8,055,060 (GRCm39) nonsense probably null
R6247:Apob UTSW 12 8,051,801 (GRCm39) missense probably damaging 1.00
R6279:Apob UTSW 12 8,057,769 (GRCm39) nonsense probably null
R6300:Apob UTSW 12 8,057,769 (GRCm39) nonsense probably null
R6320:Apob UTSW 12 8,039,194 (GRCm39) missense probably benign 0.27
R6339:Apob UTSW 12 8,066,188 (GRCm39) missense probably damaging 0.99
R6353:Apob UTSW 12 8,059,421 (GRCm39) missense probably damaging 1.00
R6395:Apob UTSW 12 8,058,507 (GRCm39) missense probably benign 0.45
R6441:Apob UTSW 12 8,037,796 (GRCm39) missense probably damaging 1.00
R6492:Apob UTSW 12 8,058,261 (GRCm39) missense probably damaging 0.99
R6495:Apob UTSW 12 8,040,394 (GRCm39) missense probably null 1.00
R6502:Apob UTSW 12 8,051,814 (GRCm39) missense probably damaging 0.99
R6520:Apob UTSW 12 8,033,124 (GRCm39) missense probably damaging 1.00
R6644:Apob UTSW 12 8,059,077 (GRCm39) missense probably damaging 0.97
R6704:Apob UTSW 12 8,060,379 (GRCm39) missense probably damaging 0.98
R6750:Apob UTSW 12 8,047,853 (GRCm39) missense probably damaging 1.00
R6759:Apob UTSW 12 8,061,049 (GRCm39) missense probably benign 0.06
R6812:Apob UTSW 12 8,033,062 (GRCm39) missense probably damaging 0.98
R6865:Apob UTSW 12 8,058,847 (GRCm39) missense probably benign 0.05
R6873:Apob UTSW 12 8,065,995 (GRCm39) missense probably benign 0.00
R7013:Apob UTSW 12 8,060,080 (GRCm39) nonsense probably null
R7067:Apob UTSW 12 8,059,423 (GRCm39) missense probably damaging 1.00
R7084:Apob UTSW 12 8,059,591 (GRCm39) missense probably benign
R7113:Apob UTSW 12 8,045,539 (GRCm39) missense probably damaging 1.00
R7175:Apob UTSW 12 8,057,034 (GRCm39) missense probably benign 0.33
R7196:Apob UTSW 12 8,033,893 (GRCm39) missense possibly damaging 0.90
R7199:Apob UTSW 12 8,055,072 (GRCm39) missense probably damaging 1.00
R7205:Apob UTSW 12 8,055,087 (GRCm39) missense probably damaging 0.98
R7251:Apob UTSW 12 8,057,037 (GRCm39) missense probably damaging 0.98
R7474:Apob UTSW 12 8,059,185 (GRCm39) missense probably benign 0.29
R7484:Apob UTSW 12 8,056,884 (GRCm39) nonsense probably null
R7538:Apob UTSW 12 8,052,219 (GRCm39) missense probably damaging 0.98
R7636:Apob UTSW 12 8,059,516 (GRCm39) missense possibly damaging 0.86
R7646:Apob UTSW 12 8,059,189 (GRCm39) missense probably damaging 0.99
R7787:Apob UTSW 12 8,040,780 (GRCm39) missense probably damaging 0.97
R7793:Apob UTSW 12 8,058,124 (GRCm39) missense probably damaging 0.99
R7836:Apob UTSW 12 8,051,885 (GRCm39) missense possibly damaging 0.72
R7895:Apob UTSW 12 8,061,933 (GRCm39) missense probably benign 0.00
R8005:Apob UTSW 12 8,059,744 (GRCm39) missense probably benign 0.01
R8013:Apob UTSW 12 8,060,798 (GRCm39) missense possibly damaging 0.94
R8014:Apob UTSW 12 8,060,798 (GRCm39) missense possibly damaging 0.94
R8111:Apob UTSW 12 8,058,801 (GRCm39) missense probably benign 0.16
R8117:Apob UTSW 12 8,056,435 (GRCm39) missense probably damaging 0.99
R8226:Apob UTSW 12 8,059,056 (GRCm39) missense probably benign 0.00
R8244:Apob UTSW 12 8,060,548 (GRCm39) missense probably damaging 0.96
R8280:Apob UTSW 12 8,060,851 (GRCm39) missense possibly damaging 0.46
R8310:Apob UTSW 12 8,059,033 (GRCm39) missense probably benign 0.00
R8327:Apob UTSW 12 8,051,015 (GRCm39) missense possibly damaging 0.72
R8329:Apob UTSW 12 8,061,135 (GRCm39) missense probably damaging 0.98
R8331:Apob UTSW 12 8,051,882 (GRCm39) missense probably benign 0.28
R8351:Apob UTSW 12 8,056,356 (GRCm39) missense probably benign 0.29
R8412:Apob UTSW 12 8,058,069 (GRCm39) missense probably benign 0.33
R8425:Apob UTSW 12 8,038,842 (GRCm39) missense possibly damaging 0.70
R8481:Apob UTSW 12 8,044,807 (GRCm39) splice site probably null
R8493:Apob UTSW 12 8,059,009 (GRCm39) missense possibly damaging 0.87
R8529:Apob UTSW 12 8,057,353 (GRCm39) missense probably damaging 1.00
R8554:Apob UTSW 12 8,037,830 (GRCm39) missense probably damaging 0.98
R8692:Apob UTSW 12 8,058,270 (GRCm39) missense probably damaging 0.98
R8695:Apob UTSW 12 8,057,830 (GRCm39) missense probably damaging 1.00
R8977:Apob UTSW 12 8,065,990 (GRCm39) missense probably damaging 0.99
R9016:Apob UTSW 12 8,035,408 (GRCm39) splice site silent
R9020:Apob UTSW 12 8,063,999 (GRCm39) missense probably damaging 1.00
R9037:Apob UTSW 12 8,066,501 (GRCm39) missense probably benign 0.15
R9053:Apob UTSW 12 8,058,954 (GRCm39) missense possibly damaging 0.72
R9062:Apob UTSW 12 8,058,046 (GRCm39) missense possibly damaging 0.91
R9142:Apob UTSW 12 8,062,705 (GRCm39) missense possibly damaging 0.95
R9180:Apob UTSW 12 8,047,925 (GRCm39) missense probably damaging 1.00
R9205:Apob UTSW 12 8,030,635 (GRCm39) missense probably damaging 0.99
R9248:Apob UTSW 12 8,065,231 (GRCm39) nonsense probably null
R9277:Apob UTSW 12 8,061,183 (GRCm39) missense probably benign 0.01
R9305:Apob UTSW 12 8,058,053 (GRCm39) missense probably benign 0.04
R9358:Apob UTSW 12 8,060,833 (GRCm39) missense probably benign 0.14
R9375:Apob UTSW 12 8,029,261 (GRCm39) missense possibly damaging 0.91
R9385:Apob UTSW 12 8,056,399 (GRCm39) missense possibly damaging 0.91
R9386:Apob UTSW 12 8,056,629 (GRCm39) missense probably damaging 0.99
R9392:Apob UTSW 12 8,057,098 (GRCm39) missense probably benign 0.45
R9470:Apob UTSW 12 8,039,219 (GRCm39) missense possibly damaging 0.94
R9523:Apob UTSW 12 8,052,069 (GRCm39) missense probably damaging 1.00
R9545:Apob UTSW 12 8,033,890 (GRCm39) missense possibly damaging 0.81
R9629:Apob UTSW 12 8,059,054 (GRCm39) missense probably damaging 1.00
R9702:Apob UTSW 12 8,057,559 (GRCm39) missense probably damaging 0.96
R9703:Apob UTSW 12 8,030,507 (GRCm39) missense probably damaging 0.99
R9719:Apob UTSW 12 8,065,464 (GRCm39) missense probably benign 0.15
R9726:Apob UTSW 12 8,056,926 (GRCm39) missense probably damaging 0.99
R9729:Apob UTSW 12 8,066,125 (GRCm39) missense probably damaging 0.99
X0027:Apob UTSW 12 8,057,975 (GRCm39) missense probably benign
Z1088:Apob UTSW 12 8,062,936 (GRCm39) missense possibly damaging 0.95
Z1088:Apob UTSW 12 8,055,945 (GRCm39) nonsense probably null
Z1088:Apob UTSW 12 8,055,074 (GRCm39) missense possibly damaging 0.91
Z1176:Apob UTSW 12 8,054,978 (GRCm39) missense probably benign 0.00
Z1176:Apob UTSW 12 8,048,011 (GRCm39) missense probably damaging 1.00
Z1177:Apob UTSW 12 8,065,249 (GRCm39) frame shift probably null
Z1177:Apob UTSW 12 8,038,765 (GRCm39) missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- ATCAGCACGGCTCTTGAACAC -3'
(R):5'- TCGCATGGCTTCCAGTAGAC -3'

Sequencing Primer
(F):5'- ACAGTCAGTGCCTTGCTG -3'
(R):5'- GCATGGCTTCCAGTAGACTTATC -3'
Posted On 2014-06-23