Incidental Mutation 'R1843:Pcnx'
ID207459
Institutional Source Beutler Lab
Gene Symbol Pcnx
Ensembl Gene ENSMUSG00000021140
Gene Namepecanex homolog
Synonyms3526401J03Rik, 2900024E21Rik
MMRRC Submission 039868-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1843 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location81860023-82000924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 81980935 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1585 (L1585P)
Ref Sequence ENSEMBL: ENSMUSP00000152104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021567] [ENSMUST00000221721] [ENSMUST00000222005]
Predicted Effect probably damaging
Transcript: ENSMUST00000021567
AA Change: L1591P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021567
Gene: ENSMUSG00000021140
AA Change: L1591P

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 52 74 N/A INTRINSIC
low complexity region 369 390 N/A INTRINSIC
low complexity region 407 422 N/A INTRINSIC
low complexity region 509 525 N/A INTRINSIC
low complexity region 616 638 N/A INTRINSIC
low complexity region 672 692 N/A INTRINSIC
low complexity region 764 783 N/A INTRINSIC
low complexity region 817 835 N/A INTRINSIC
low complexity region 842 853 N/A INTRINSIC
low complexity region 911 922 N/A INTRINSIC
transmembrane domain 1006 1028 N/A INTRINSIC
transmembrane domain 1035 1052 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1113 1135 N/A INTRINSIC
transmembrane domain 1163 1185 N/A INTRINSIC
transmembrane domain 1197 1216 N/A INTRINSIC
transmembrane domain 1269 1291 N/A INTRINSIC
transmembrane domain 1298 1315 N/A INTRINSIC
Pfam:Pecanex_C 1785 2011 1.6e-118 PFAM
low complexity region 2125 2140 N/A INTRINSIC
low complexity region 2195 2202 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000221675
AA Change: L952P
Predicted Effect probably damaging
Transcript: ENSMUST00000221721
AA Change: L1585P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000222005
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an evolutionarily conserved transmembrane protein similar to the pecanex protein in Drosophila. The fly protein is a component of the Notch signaling pathway, which functions in several developmental processes. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik C T 8: 105,708,974 T88M probably damaging Het
9130011E15Rik A C 19: 45,975,252 S42R probably benign Het
9430038I01Rik A G 7: 137,377,066 probably benign Het
Adgra3 A C 5: 49,961,492 S905A probably damaging Het
Adgrv1 A G 13: 81,544,533 Y1618H probably damaging Het
Anapc15-ps T C 10: 95,673,314 T26A probably benign Het
Ankrd13d T C 19: 4,271,595 K360E probably damaging Het
Anks1b T A 10: 90,512,889 probably null Het
Apob T C 12: 8,007,602 F2028S possibly damaging Het
Arap3 G A 18: 37,975,583 R1265W probably damaging Het
Arhgef37 A G 18: 61,518,050 Y135H probably damaging Het
Atp1a1 T C 3: 101,582,017 T760A probably benign Het
Cdc42bpb T A 12: 111,322,821 M497L probably benign Het
Ces5a C T 8: 93,514,231 V413M probably damaging Het
Chd5 A T 4: 152,385,806 Y1903F probably damaging Het
Chd9 T A 8: 91,010,794 N1500K probably benign Het
Chmp7 G T 14: 69,719,799 D303E probably benign Het
Chrnb4 A T 9: 55,034,818 Y391N possibly damaging Het
Crtc1 T C 8: 70,388,152 T475A probably benign Het
Cyp2c69 A G 19: 39,877,528 I207T probably benign Het
Dcp1a A G 14: 30,518,983 E250G probably damaging Het
Ddx20 T C 3: 105,679,082 Q649R probably benign Het
Defb12 T A 8: 19,112,738 K59N probably damaging Het
Dpy19l3 A T 7: 35,729,760 I85N probably damaging Het
Duox2 C T 2: 122,292,258 probably null Het
E430018J23Rik A C 7: 127,391,488 D442E probably benign Het
Ebi3 T A 17: 55,956,679 Y197N probably damaging Het
Emc1 G A 4: 139,375,512 R994Q probably benign Het
Ercc6 G T 14: 32,546,820 M530I probably damaging Het
Evl T A 12: 108,652,996 D70E probably damaging Het
Fam35a A G 14: 34,267,803 I382T probably benign Het
Fbln2 A G 6: 91,265,775 N819S probably damaging Het
Foxk2 A G 11: 121,285,537 I170V probably benign Het
Gfm1 T C 3: 67,435,610 V159A probably damaging Het
Gm10837 A G 14: 122,490,765 T18A unknown Het
Gm12887 A T 4: 121,622,030 V25E probably damaging Het
Hectd4 A G 5: 121,297,180 H985R possibly damaging Het
Hsfy2 A G 1: 56,636,632 Y249H possibly damaging Het
Hspg2 T C 4: 137,545,567 V2639A probably damaging Het
Igf2r A G 17: 12,704,270 probably null Het
Invs T A 4: 48,422,035 I889N probably damaging Het
Kcnq1 A T 7: 143,183,120 M209L probably benign Het
Klra7 A G 6: 130,229,994 I48T possibly damaging Het
Krt26 CTAGTA CTA 11: 99,333,526 probably benign Het
Lrif1 T A 3: 106,732,811 V404D probably damaging Het
Lrriq1 T A 10: 103,227,173 probably null Het
Lypd6 T A 2: 50,188,762 I90N possibly damaging Het
Mbp A G 18: 82,584,122 D174G probably damaging Het
Megf9 G T 4: 70,534,785 P13Q probably damaging Het
Myo15b A T 11: 115,869,586 T1155S probably benign Het
Nlrp6 T A 7: 140,923,093 C371S probably damaging Het
Nosip T A 7: 45,077,309 probably null Het
Nox3 G T 17: 3,669,878 P344H probably damaging Het
Nup210l T C 3: 90,172,086 V959A probably damaging Het
Olfr1360 C A 13: 21,674,672 V91L probably benign Het
Olfr1475 A G 19: 13,479,931 I89T probably benign Het
Olfr175-ps1 T A 16: 58,824,077 I211F probably damaging Het
Olfr267 T C 4: 58,785,384 I113V probably benign Het
Olfr959 A G 9: 39,572,735 Y175H possibly damaging Het
Osbpl3 A C 6: 50,370,143 S25A probably damaging Het
Otog G A 7: 46,246,283 C107Y probably damaging Het
Pax7 G A 4: 139,784,491 R260C probably damaging Het
Pbrm1 A T 14: 31,038,957 I224F probably damaging Het
Pcdh1 T A 18: 38,192,225 probably null Het
Pde4c C T 8: 70,747,950 H362Y probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pgm2 A T 4: 99,961,478 Q90L probably damaging Het
Phlpp1 A G 1: 106,343,505 H814R probably benign Het
Pknox2 A T 9: 36,954,831 M5K possibly damaging Het
Pole G A 5: 110,330,835 probably null Het
Polr1b A G 2: 129,102,966 I61V probably benign Het
Prelp T C 1: 133,914,757 K217E probably damaging Het
Prkce C T 17: 86,475,546 Q202* probably null Het
Psmd2 T G 16: 20,656,582 M370R probably benign Het
Rimklb A T 6: 122,464,009 H68Q probably damaging Het
Rnasel A G 1: 153,754,674 D312G possibly damaging Het
Rxrg A T 1: 167,598,752 M1L probably benign Het
Scrn1 A G 6: 54,522,841 F220L possibly damaging Het
Scyl3 A G 1: 163,950,675 S461G probably benign Het
Serpina1c T A 12: 103,895,023 T411S probably benign Het
Serpinb6d C T 13: 33,671,381 P346L probably benign Het
Slc9a3r2 C T 17: 24,641,719 S150N possibly damaging Het
Spg21 G T 9: 65,465,336 V17F probably damaging Het
Spink5 A T 18: 43,999,891 M525L probably benign Het
Sun2 T C 15: 79,737,563 T155A probably benign Het
Tchh T A 3: 93,446,780 F1176I unknown Het
Tex15 T A 8: 33,576,654 D2037E probably benign Het
Tfdp2 T C 9: 96,317,804 C392R possibly damaging Het
Tmem30c T C 16: 57,276,780 N139S probably benign Het
Tns2 C T 15: 102,113,133 probably null Het
Trim66 T C 7: 109,475,839 E405G probably damaging Het
Trpc4 T A 3: 54,279,994 F456I probably benign Het
Tspo2 T C 17: 48,448,790 D108G possibly damaging Het
Tyk2 A T 9: 21,121,554 C304* probably null Het
Vgll4 A T 6: 114,862,795 S185T probably benign Het
Vmn2r94 A C 17: 18,244,470 S519R probably benign Het
Vmn2r96 T G 17: 18,597,921 S587A probably benign Het
Vps4b C A 1: 106,778,982 A287S possibly damaging Het
Yeats2 C T 16: 20,229,564 P1332S probably benign Het
Zfp462 T G 4: 55,010,010 S659A possibly damaging Het
Zfp507 C T 7: 35,793,725 R631Q probably damaging Het
Zswim5 G T 4: 116,877,699 E80D unknown Het
Other mutations in Pcnx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Pcnx APN 12 81895101 missense probably damaging 0.98
IGL00561:Pcnx APN 12 81996053 missense probably damaging 1.00
IGL01066:Pcnx APN 12 81992021 missense possibly damaging 0.87
IGL01069:Pcnx APN 12 81918144 missense probably benign 0.27
IGL01082:Pcnx APN 12 81990598 missense possibly damaging 0.62
IGL01087:Pcnx APN 12 81995339 splice site probably benign
IGL01145:Pcnx APN 12 81992035 missense probably damaging 0.99
IGL01412:Pcnx APN 12 81906465 missense probably damaging 1.00
IGL01477:Pcnx APN 12 81973241 missense probably damaging 0.98
IGL01639:Pcnx APN 12 81950320 critical splice donor site probably null
IGL01815:Pcnx APN 12 81990551 missense probably damaging 1.00
IGL01870:Pcnx APN 12 81975893 missense probably benign 0.01
IGL01902:Pcnx APN 12 81979094 missense probably damaging 1.00
IGL01935:Pcnx APN 12 81917816 missense probably benign 0.00
IGL02141:Pcnx APN 12 81860382 missense possibly damaging 0.86
IGL02179:Pcnx APN 12 81933719 intron probably benign
IGL02197:Pcnx APN 12 81919104 missense probably benign 0.01
IGL02197:Pcnx APN 12 81993151 missense possibly damaging 0.85
IGL02238:Pcnx APN 12 81917914 missense probably damaging 1.00
IGL02430:Pcnx APN 12 81919322 missense possibly damaging 0.89
IGL02590:Pcnx APN 12 81994978 missense probably damaging 1.00
IGL02992:Pcnx APN 12 81964120 missense probably damaging 1.00
IGL03304:Pcnx APN 12 81982029 missense probably damaging 1.00
PIT4515001:Pcnx UTSW 12 81991787 missense
R0086:Pcnx UTSW 12 81992058 unclassified probably benign
R0114:Pcnx UTSW 12 81996095 missense possibly damaging 0.95
R0240:Pcnx UTSW 12 81947018 missense possibly damaging 0.67
R0240:Pcnx UTSW 12 81947018 missense possibly damaging 0.67
R0376:Pcnx UTSW 12 81974579 splice site probably benign
R0377:Pcnx UTSW 12 81974579 splice site probably benign
R0416:Pcnx UTSW 12 81974466 missense probably benign 0.09
R0514:Pcnx UTSW 12 81995110 missense probably benign 0.21
R0563:Pcnx UTSW 12 81917944 missense probably damaging 1.00
R0569:Pcnx UTSW 12 81992030 missense probably benign 0.08
R0626:Pcnx UTSW 12 81983676 missense possibly damaging 0.82
R0972:Pcnx UTSW 12 81913412 missense probably damaging 1.00
R1205:Pcnx UTSW 12 81956243 missense probably damaging 1.00
R1455:Pcnx UTSW 12 81973234 missense probably damaging 1.00
R1514:Pcnx UTSW 12 81918798 missense probably damaging 1.00
R1731:Pcnx UTSW 12 81990704 missense probably damaging 1.00
R1758:Pcnx UTSW 12 81983484 missense probably benign 0.27
R1774:Pcnx UTSW 12 81975320 missense probably damaging 1.00
R1817:Pcnx UTSW 12 81918642 missense probably benign
R1862:Pcnx UTSW 12 81918732 missense probably damaging 1.00
R2042:Pcnx UTSW 12 81918293 missense probably damaging 1.00
R2054:Pcnx UTSW 12 81933674 missense probably benign 0.02
R2243:Pcnx UTSW 12 81918705 missense probably damaging 1.00
R2272:Pcnx UTSW 12 81995314 missense probably benign 0.26
R2360:Pcnx UTSW 12 81950186 missense probably damaging 0.99
R2926:Pcnx UTSW 12 81994995 missense probably damaging 1.00
R3607:Pcnx UTSW 12 81928292 missense probably damaging 1.00
R3781:Pcnx UTSW 12 81996118 missense probably benign 0.00
R3782:Pcnx UTSW 12 81996118 missense probably benign 0.00
R3806:Pcnx UTSW 12 81950137 missense possibly damaging 0.84
R3926:Pcnx UTSW 12 81958731 missense probably damaging 1.00
R4019:Pcnx UTSW 12 81918244 missense probably damaging 1.00
R4020:Pcnx UTSW 12 81918244 missense probably damaging 1.00
R4683:Pcnx UTSW 12 81986672 missense probably benign 0.01
R4703:Pcnx UTSW 12 81895164 missense probably benign 0.01
R4732:Pcnx UTSW 12 81995751 missense probably benign 0.01
R4733:Pcnx UTSW 12 81995751 missense probably benign 0.01
R4755:Pcnx UTSW 12 81950294 missense probably damaging 1.00
R4792:Pcnx UTSW 12 81919151 missense probably damaging 1.00
R4897:Pcnx UTSW 12 81918165 missense probably damaging 1.00
R4915:Pcnx UTSW 12 81974495 missense probably benign 0.10
R4934:Pcnx UTSW 12 81991825 missense possibly damaging 0.76
R4940:Pcnx UTSW 12 81917793 missense possibly damaging 0.60
R5079:Pcnx UTSW 12 81979089 nonsense probably null
R5087:Pcnx UTSW 12 81994939 missense probably damaging 1.00
R5284:Pcnx UTSW 12 81919029 missense probably benign 0.02
R5287:Pcnx UTSW 12 81982051 missense probably damaging 1.00
R5436:Pcnx UTSW 12 81860406 missense probably damaging 1.00
R5505:Pcnx UTSW 12 81950153 missense probably damaging 1.00
R5538:Pcnx UTSW 12 81860409 missense probably damaging 1.00
R5632:Pcnx UTSW 12 81917730 missense probably damaging 1.00
R5642:Pcnx UTSW 12 81895029 missense possibly damaging 0.45
R5841:Pcnx UTSW 12 81918655 missense possibly damaging 0.62
R6275:Pcnx UTSW 12 81918607 missense probably benign 0.34
R6508:Pcnx UTSW 12 81912705 missense probably damaging 0.98
R6532:Pcnx UTSW 12 81980964 missense probably damaging 1.00
R6634:Pcnx UTSW 12 81917882 nonsense probably null
R6753:Pcnx UTSW 12 81964480 missense probably damaging 1.00
R6776:Pcnx UTSW 12 81962722 missense possibly damaging 0.81
R6778:Pcnx UTSW 12 81918871 missense probably damaging 1.00
R6890:Pcnx UTSW 12 81971376 missense probably benign 0.09
R6894:Pcnx UTSW 12 81987973 missense probably damaging 1.00
R6927:Pcnx UTSW 12 81917812 missense probably benign 0.37
R7173:Pcnx UTSW 12 81953003 intron probably null
R7196:Pcnx UTSW 12 81995538 missense possibly damaging 0.94
R7316:Pcnx UTSW 12 81995549 missense probably benign 0.16
R7559:Pcnx UTSW 12 81993122 missense unknown
R7635:Pcnx UTSW 12 81919125 missense
R7669:Pcnx UTSW 12 81990551 missense probably damaging 1.00
R8021:Pcnx UTSW 12 81918819 nonsense probably null
R8049:Pcnx UTSW 12 81918819 nonsense probably null
RF024:Pcnx UTSW 12 81917727 missense probably damaging 0.98
Z1177:Pcnx UTSW 12 81918202 missense probably damaging 0.98
Z1177:Pcnx UTSW 12 81918677 missense
Predicted Primers PCR Primer
(F):5'- CCATAAGGAGCTTAGGTTTAGGC -3'
(R):5'- CTCTGACAGCTTTCATTTGGG -3'

Sequencing Primer
(F):5'- GCCTAGGCTAGCTCCAGATTTG -3'
(R):5'- GGGATTTAAATAGACACAACTTTGC -3'
Posted On2014-06-23