Incidental Mutation 'R0115:March6'
ID20748
Institutional Source Beutler Lab
Gene Symbol March6
Ensembl Gene ENSMUSG00000039100
Gene Namemembrane-associated ring finger (C3HC4) 6
SynonymsF830029L24Rik
MMRRC Submission 038401-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.564) question?
Stock #R0115 (G1)
Quality Score206
Status Validated (trace)
Chromosome15
Chromosomal Location31455891-31531053 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 31475812 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 633 (F633I)
Ref Sequence ENSEMBL: ENSMUSP00000087694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090227]
Predicted Effect probably benign
Transcript: ENSMUST00000090227
AA Change: F633I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000087694
Gene: ENSMUSG00000039100
AA Change: F633I

DomainStartEndE-ValueType
RINGv 8 56 1.13e-21 SMART
transmembrane domain 92 114 N/A INTRINSIC
transmembrane domain 141 163 N/A INTRINSIC
low complexity region 223 259 N/A INTRINSIC
transmembrane domain 290 312 N/A INTRINSIC
transmembrane domain 332 354 N/A INTRINSIC
transmembrane domain 367 389 N/A INTRINSIC
transmembrane domain 420 442 N/A INTRINSIC
transmembrane domain 480 502 N/A INTRINSIC
transmembrane domain 522 540 N/A INTRINSIC
low complexity region 574 599 N/A INTRINSIC
transmembrane domain 633 655 N/A INTRINSIC
transmembrane domain 675 697 N/A INTRINSIC
transmembrane domain 720 742 N/A INTRINSIC
transmembrane domain 762 784 N/A INTRINSIC
transmembrane domain 805 827 N/A INTRINSIC
transmembrane domain 847 866 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226868
Meta Mutation Damage Score 0.0606 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.2%
  • 20x: 86.0%
Validation Efficiency 98% (98/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of membrane-associated E3 ubiquitin ligases containing RING-CH-type zinc finger motifs. Ubiquitination of type II deiodinase by the encoded protein is an important regulatory step in thyroid hormone signalling. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik G A 18: 57,594,142 probably benign Het
2310007B03Rik A T 1: 93,159,725 S135R possibly damaging Het
4921528I07Rik A G 9: 114,279,384 noncoding transcript Het
Alas1 A T 9: 106,238,252 probably null Het
Arf5 A G 6: 28,426,076 Y154C probably damaging Het
Arhgap20 T A 9: 51,838,972 I344N probably damaging Het
Arhgap30 A C 1: 171,407,948 E630A possibly damaging Het
B4galt5 A G 2: 167,309,234 L118P probably damaging Het
Bdp1 A G 13: 100,041,454 I1969T probably benign Het
Bysl C T 17: 47,610,942 R77Q probably benign Het
Cap1 A T 4: 122,863,075 H272Q possibly damaging Het
Ccdc146 T C 5: 21,322,756 I187M possibly damaging Het
Cdk13 C A 13: 17,719,494 A1123S probably damaging Het
Ces5a A T 8: 93,502,183 M473K probably damaging Het
Chd8 A G 14: 52,237,206 S123P probably benign Het
Cwc22 G A 2: 77,908,111 A497V probably damaging Het
Cwh43 T C 5: 73,418,027 S296P probably damaging Het
Cyp2c50 T A 19: 40,092,393 probably benign Het
Dlg1 C A 16: 31,805,690 Y399* probably null Het
Drosha A T 15: 12,846,130 E92D probably benign Het
Fanca C T 8: 123,268,539 G1408D probably benign Het
Frem1 T A 4: 82,936,169 D1621V possibly damaging Het
Frem2 G A 3: 53,656,208 R293C probably damaging Het
Fut8 T A 12: 77,448,560 V308D probably damaging Het
Glipr1 A G 10: 111,993,541 I105T probably benign Het
Glmn A T 5: 107,560,934 S385T probably benign Het
Gm281 A G 14: 13,899,571 V117A probably damaging Het
Gon4l T A 3: 88,895,682 V1200D probably damaging Het
Gpc1 G A 1: 92,857,499 D387N probably damaging Het
Gsdmc A G 15: 63,803,637 Y110H probably damaging Het
Gucy1b1 T A 3: 82,034,391 H586L probably benign Het
Gucy2e A G 11: 69,236,632 L5P unknown Het
Hectd4 A G 5: 121,295,506 probably benign Het
Hmcn1 T A 1: 150,808,647 I391F possibly damaging Het
Hsf4 A T 8: 105,272,704 probably null Het
I830077J02Rik G A 3: 105,926,570 T90M probably damaging Het
Ino80 A T 2: 119,431,016 H722Q probably damaging Het
Kcnma1 C A 14: 23,314,175 R980L probably damaging Het
Kif1a A G 1: 93,046,778 probably benign Het
Klhdc7b A G 15: 89,388,521 H1202R probably benign Het
Lig3 A G 11: 82,793,935 D559G probably damaging Het
Lyst T C 13: 13,677,952 V2179A probably benign Het
Mansc4 A G 6: 147,075,227 I297T possibly damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Megf10 G T 18: 57,259,802 V424L possibly damaging Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mib2 A G 4: 155,656,062 probably benign Het
Mut C T 17: 40,956,227 T564M probably damaging Het
Myh8 A G 11: 67,306,264 probably benign Het
Mypn T C 10: 63,192,380 probably benign Het
Nf1 G A 11: 79,468,876 probably null Het
Notch3 T A 17: 32,133,462 T1866S possibly damaging Het
Olfr108 C T 17: 37,445,779 A86V probably benign Het
Olfr1189 A T 2: 88,592,655 I284F probably damaging Het
Olfr1301 T A 2: 111,754,585 M112K probably damaging Het
Olfr390 A G 11: 73,787,315 I126V possibly damaging Het
Pkhd1 A T 1: 20,350,490 I2464N probably damaging Het
Pkn1 A G 8: 83,671,029 S817P probably damaging Het
Prkg2 A T 5: 98,994,655 probably null Het
Prl8a6 T C 13: 27,433,101 D201G probably benign Het
Psmd1 C T 1: 86,083,271 T356I possibly damaging Het
Ptk6 G A 2: 181,202,527 probably benign Het
Ptprn2 T C 12: 117,211,846 probably benign Het
Rbm42 G A 7: 30,647,775 T106I probably damaging Het
Rims4 A T 2: 163,864,120 V198E probably damaging Het
Ripk1 T C 13: 34,009,750 S32P probably damaging Het
Rorc T C 3: 94,377,609 probably benign Het
Rpl22l1 T C 3: 28,806,536 F15L probably damaging Het
Slc6a20a C A 9: 123,678,758 A17S possibly damaging Het
Sorcs1 A G 19: 50,636,453 probably benign Het
Sp100 A G 1: 85,650,131 probably benign Het
Ssc5d G A 7: 4,927,881 probably benign Het
Taf11 A G 17: 27,907,661 L4P probably benign Het
Tm2d3 A G 7: 65,695,334 probably benign Het
Tmub2 T C 11: 102,288,375 probably null Het
Trim34a T A 7: 104,247,902 C58S probably damaging Het
Trpc3 T C 3: 36,624,417 I840V probably benign Het
Trpm6 T C 19: 18,829,952 V1020A probably damaging Het
Vmn1r214 T A 13: 23,035,294 Y319* probably null Het
Vmn1r59 T C 7: 5,454,116 N215S probably benign Het
Vmn2r74 T C 7: 85,957,356 M261V probably benign Het
Vmn2r89 T C 14: 51,456,120 F309S probably damaging Het
Wdr95 A T 5: 149,564,390 D163V probably damaging Het
Xirp2 T A 2: 67,509,909 F831L possibly damaging Het
Ythdc2 C T 18: 44,841,423 probably benign Het
Other mutations in March6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:March6 APN 15 31475763 missense probably benign 0.00
IGL00902:March6 APN 15 31484978 missense probably damaging 1.00
IGL02352:March6 APN 15 31509759 missense probably damaging 1.00
IGL02359:March6 APN 15 31509759 missense probably damaging 1.00
IGL02565:March6 APN 15 31490566 splice site probably benign
IGL02735:March6 APN 15 31486120 missense probably benign 0.00
IGL02808:March6 APN 15 31478406 missense probably benign 0.32
IGL03122:March6 APN 15 31478293 critical splice donor site probably null
IGL03235:March6 APN 15 31485995 missense probably damaging 1.00
IGL03238:March6 APN 15 31461941 critical splice donor site probably benign
IGL03263:March6 APN 15 31486362 missense probably benign 0.01
R0003:March6 UTSW 15 31469532 splice site probably benign
R0056:March6 UTSW 15 31467734 missense possibly damaging 0.68
R0126:March6 UTSW 15 31462005 missense probably benign 0.00
R0148:March6 UTSW 15 31490612 missense probably damaging 0.99
R0744:March6 UTSW 15 31480291 missense probably benign 0.00
R0833:March6 UTSW 15 31480291 missense probably benign 0.00
R1205:March6 UTSW 15 31469673 missense probably benign 0.01
R1339:March6 UTSW 15 31486402 missense probably benign 0.12
R1485:March6 UTSW 15 31498693 missense probably damaging 0.96
R1885:March6 UTSW 15 31502806 missense probably benign 0.00
R1889:March6 UTSW 15 31459193 missense possibly damaging 0.86
R1984:March6 UTSW 15 31469646 missense probably damaging 0.99
R2007:March6 UTSW 15 31461941 critical splice donor site probably null
R2046:March6 UTSW 15 31486434 missense probably benign 0.01
R2135:March6 UTSW 15 31509764 nonsense probably null
R3116:March6 UTSW 15 31486119 missense probably benign 0.00
R3710:March6 UTSW 15 31509826 splice site probably benign
R3715:March6 UTSW 15 31465259 missense probably benign 0.00
R3749:March6 UTSW 15 31462014 missense probably benign 0.00
R3944:March6 UTSW 15 31488814 missense probably benign 0.00
R4327:March6 UTSW 15 31498741 missense probably benign 0.17
R4329:March6 UTSW 15 31498741 missense probably benign 0.17
R5001:March6 UTSW 15 31465322 missense probably damaging 0.98
R5149:March6 UTSW 15 31461994 missense possibly damaging 0.53
R5654:March6 UTSW 15 31485936 missense probably damaging 1.00
R6163:March6 UTSW 15 31465351 missense probably benign
R6172:March6 UTSW 15 31482867 missense possibly damaging 0.86
R6381:March6 UTSW 15 31467692 missense probably benign 0.01
R6888:March6 UTSW 15 31459233 missense probably benign 0.00
R7347:March6 UTSW 15 31486359 missense probably benign 0.00
R8029:March6 UTSW 15 31496002 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AACCAGGAGTGGCTTCCTCGTTAG -3'
(R):5'- TGAGGACTCTCTACCCTGAAAGCAC -3'

Sequencing Primer
(F):5'- GGCTTCCTCGTTAGATGAAGAAAC -3'
(R):5'- ACAGGTGCAGGCTGTCTC -3'
Posted On2013-04-11