Incidental Mutation 'R1843:Olfr175-ps1'
ID207481
Institutional Source Beutler Lab
Gene Symbol Olfr175-ps1
Ensembl Gene ENSMUSG00000060663
Gene Nameolfactory receptor 175, pseudogene 1
SynonymsGA_x54KRFPKG5P-55026345-55025418, GA_x54KRFPKG5P-54993816-54992890, MOR184-1, Olfr174, MOR184-10P
MMRRC Submission 039868-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R1843 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location58823662-58826782 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58824077 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 211 (I211F)
Ref Sequence ENSEMBL: ENSMUSP00000150202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079955] [ENSMUST00000215069]
Predicted Effect probably damaging
Transcript: ENSMUST00000079955
AA Change: I211F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000078873
Gene: ENSMUSG00000060663
AA Change: I211F

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.3e-52 PFAM
Pfam:7TM_GPCR_Srsx 35 305 6.8e-6 PFAM
Pfam:7tm_1 41 290 2.5e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215069
AA Change: I211F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik C T 8: 105,708,974 T88M probably damaging Het
9130011E15Rik A C 19: 45,975,252 S42R probably benign Het
9430038I01Rik A G 7: 137,377,066 probably benign Het
Adgra3 A C 5: 49,961,492 S905A probably damaging Het
Adgrv1 A G 13: 81,544,533 Y1618H probably damaging Het
Anapc15-ps T C 10: 95,673,314 T26A probably benign Het
Ankrd13d T C 19: 4,271,595 K360E probably damaging Het
Anks1b T A 10: 90,512,889 probably null Het
Apob T C 12: 8,007,602 F2028S possibly damaging Het
Arap3 G A 18: 37,975,583 R1265W probably damaging Het
Arhgef37 A G 18: 61,518,050 Y135H probably damaging Het
Atp1a1 T C 3: 101,582,017 T760A probably benign Het
Cdc42bpb T A 12: 111,322,821 M497L probably benign Het
Ces5a C T 8: 93,514,231 V413M probably damaging Het
Chd5 A T 4: 152,385,806 Y1903F probably damaging Het
Chd9 T A 8: 91,010,794 N1500K probably benign Het
Chmp7 G T 14: 69,719,799 D303E probably benign Het
Chrnb4 A T 9: 55,034,818 Y391N possibly damaging Het
Crtc1 T C 8: 70,388,152 T475A probably benign Het
Cyp2c69 A G 19: 39,877,528 I207T probably benign Het
Dcp1a A G 14: 30,518,983 E250G probably damaging Het
Ddx20 T C 3: 105,679,082 Q649R probably benign Het
Defb12 T A 8: 19,112,738 K59N probably damaging Het
Dpy19l3 A T 7: 35,729,760 I85N probably damaging Het
Duox2 C T 2: 122,292,258 probably null Het
E430018J23Rik A C 7: 127,391,488 D442E probably benign Het
Ebi3 T A 17: 55,956,679 Y197N probably damaging Het
Emc1 G A 4: 139,375,512 R994Q probably benign Het
Ercc6 G T 14: 32,546,820 M530I probably damaging Het
Evl T A 12: 108,652,996 D70E probably damaging Het
Fam35a A G 14: 34,267,803 I382T probably benign Het
Fbln2 A G 6: 91,265,775 N819S probably damaging Het
Foxk2 A G 11: 121,285,537 I170V probably benign Het
Gfm1 T C 3: 67,435,610 V159A probably damaging Het
Gm10837 A G 14: 122,490,765 T18A unknown Het
Gm12887 A T 4: 121,622,030 V25E probably damaging Het
Hectd4 A G 5: 121,297,180 H985R possibly damaging Het
Hsfy2 A G 1: 56,636,632 Y249H possibly damaging Het
Hspg2 T C 4: 137,545,567 V2639A probably damaging Het
Igf2r A G 17: 12,704,270 probably null Het
Invs T A 4: 48,422,035 I889N probably damaging Het
Kcnq1 A T 7: 143,183,120 M209L probably benign Het
Klra7 A G 6: 130,229,994 I48T possibly damaging Het
Krt26 CTAGTA CTA 11: 99,333,526 probably benign Het
Lrif1 T A 3: 106,732,811 V404D probably damaging Het
Lrriq1 T A 10: 103,227,173 probably null Het
Lypd6 T A 2: 50,188,762 I90N possibly damaging Het
Mbp A G 18: 82,584,122 D174G probably damaging Het
Megf9 G T 4: 70,534,785 P13Q probably damaging Het
Myo15b A T 11: 115,869,586 T1155S probably benign Het
Nlrp6 T A 7: 140,923,093 C371S probably damaging Het
Nosip T A 7: 45,077,309 probably null Het
Nox3 G T 17: 3,669,878 P344H probably damaging Het
Nup210l T C 3: 90,172,086 V959A probably damaging Het
Olfr1360 C A 13: 21,674,672 V91L probably benign Het
Olfr1475 A G 19: 13,479,931 I89T probably benign Het
Olfr267 T C 4: 58,785,384 I113V probably benign Het
Olfr959 A G 9: 39,572,735 Y175H possibly damaging Het
Osbpl3 A C 6: 50,370,143 S25A probably damaging Het
Otog G A 7: 46,246,283 C107Y probably damaging Het
Pax7 G A 4: 139,784,491 R260C probably damaging Het
Pbrm1 A T 14: 31,038,957 I224F probably damaging Het
Pcdh1 T A 18: 38,192,225 probably null Het
Pcnx T C 12: 81,980,935 L1585P probably damaging Het
Pde4c C T 8: 70,747,950 H362Y probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pgm2 A T 4: 99,961,478 Q90L probably damaging Het
Phlpp1 A G 1: 106,343,505 H814R probably benign Het
Pknox2 A T 9: 36,954,831 M5K possibly damaging Het
Pole G A 5: 110,330,835 probably null Het
Polr1b A G 2: 129,102,966 I61V probably benign Het
Prelp T C 1: 133,914,757 K217E probably damaging Het
Prkce C T 17: 86,475,546 Q202* probably null Het
Psmd2 T G 16: 20,656,582 M370R probably benign Het
Rimklb A T 6: 122,464,009 H68Q probably damaging Het
Rnasel A G 1: 153,754,674 D312G possibly damaging Het
Rxrg A T 1: 167,598,752 M1L probably benign Het
Scrn1 A G 6: 54,522,841 F220L possibly damaging Het
Scyl3 A G 1: 163,950,675 S461G probably benign Het
Serpina1c T A 12: 103,895,023 T411S probably benign Het
Serpinb6d C T 13: 33,671,381 P346L probably benign Het
Slc9a3r2 C T 17: 24,641,719 S150N possibly damaging Het
Spg21 G T 9: 65,465,336 V17F probably damaging Het
Spink5 A T 18: 43,999,891 M525L probably benign Het
Sun2 T C 15: 79,737,563 T155A probably benign Het
Tchh T A 3: 93,446,780 F1176I unknown Het
Tex15 T A 8: 33,576,654 D2037E probably benign Het
Tfdp2 T C 9: 96,317,804 C392R possibly damaging Het
Tmem30c T C 16: 57,276,780 N139S probably benign Het
Tns2 C T 15: 102,113,133 probably null Het
Trim66 T C 7: 109,475,839 E405G probably damaging Het
Trpc4 T A 3: 54,279,994 F456I probably benign Het
Tspo2 T C 17: 48,448,790 D108G possibly damaging Het
Tyk2 A T 9: 21,121,554 C304* probably null Het
Vgll4 A T 6: 114,862,795 S185T probably benign Het
Vmn2r94 A C 17: 18,244,470 S519R probably benign Het
Vmn2r96 T G 17: 18,597,921 S587A probably benign Het
Vps4b C A 1: 106,778,982 A287S possibly damaging Het
Yeats2 C T 16: 20,229,564 P1332S probably benign Het
Zfp462 T G 4: 55,010,010 S659A possibly damaging Het
Zfp507 C T 7: 35,793,725 R631Q probably damaging Het
Zswim5 G T 4: 116,877,699 E80D unknown Het
Other mutations in Olfr175-ps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Olfr175-ps1 APN 16 58824595 missense probably damaging 1.00
IGL01404:Olfr175-ps1 APN 16 58824595 missense probably damaging 1.00
IGL01867:Olfr175-ps1 APN 16 58823974 missense probably damaging 1.00
IGL02073:Olfr175-ps1 APN 16 58823806 missense probably benign
IGL02393:Olfr175-ps1 APN 16 58824046 missense probably damaging 0.99
IGL02474:Olfr175-ps1 APN 16 58824656 missense probably benign
IGL02548:Olfr175-ps1 APN 16 58824328 missense probably benign 0.42
IGL02948:Olfr175-ps1 APN 16 58824088 missense probably benign 0.00
PIT4504001:Olfr175-ps1 UTSW 16 58824308 missense probably benign 0.00
R0553:Olfr175-ps1 UTSW 16 58824155 missense probably damaging 0.99
R1191:Olfr175-ps1 UTSW 16 58824559 missense probably benign
R1201:Olfr175-ps1 UTSW 16 58823863 missense probably damaging 0.98
R1458:Olfr175-ps1 UTSW 16 58824676 missense probably null 0.68
R1469:Olfr175-ps1 UTSW 16 58824610 missense probably benign
R1469:Olfr175-ps1 UTSW 16 58824610 missense probably benign
R2147:Olfr175-ps1 UTSW 16 58824479 missense probably damaging 0.99
R2421:Olfr175-ps1 UTSW 16 58824346 missense probably damaging 1.00
R4370:Olfr175-ps1 UTSW 16 58824593 missense probably benign 0.00
R4621:Olfr175-ps1 UTSW 16 58824106 missense possibly damaging 0.94
R4622:Olfr175-ps1 UTSW 16 58824106 missense possibly damaging 0.94
R4623:Olfr175-ps1 UTSW 16 58824106 missense possibly damaging 0.94
R4711:Olfr175-ps1 UTSW 16 58824706 start codon destroyed probably null 0.98
R5323:Olfr175-ps1 UTSW 16 58824703 missense probably benign
R5447:Olfr175-ps1 UTSW 16 58824483 nonsense probably null
R5457:Olfr175-ps1 UTSW 16 58824433 missense probably damaging 0.97
R5546:Olfr175-ps1 UTSW 16 58824153 nonsense probably null
R5623:Olfr175-ps1 UTSW 16 58824343 missense probably benign 0.02
R5767:Olfr175-ps1 UTSW 16 58823953 missense probably benign 0.42
R6270:Olfr175-ps1 UTSW 16 58824419 missense probably damaging 1.00
R6449:Olfr175-ps1 UTSW 16 58824526 missense probably damaging 1.00
R7356:Olfr175-ps1 UTSW 16 58824355 missense probably damaging 0.99
R7521:Olfr175-ps1 UTSW 16 58823894 missense probably benign 0.00
R7638:Olfr175-ps1 UTSW 16 58824595 missense probably damaging 1.00
R7814:Olfr175-ps1 UTSW 16 58824002 missense probably damaging 0.98
X0011:Olfr175-ps1 UTSW 16 58824663 missense probably benign
Z1176:Olfr175-ps1 UTSW 16 58824307 frame shift probably null
Z1177:Olfr175-ps1 UTSW 16 58824698 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- TTCCTTCGTTGATAGAACTTGGTC -3'
(R):5'- ATGTCCAAGAAGCTCTGCCTTC -3'

Sequencing Primer
(F):5'- GAACTTGGTCGAATATATGTGTAGAG -3'
(R):5'- GTCCAAGAAGCTCTGCCTTCAAATG -3'
Posted On2014-06-23