Mutagenetix > Incidental Mutation

Incidental Mutation 'R1843:Igf2r'

207483

Institutional Source

Beutler Lab

Gene Symbol

Igf2r

Ensembl Gene

ENSMUSG00000023830

Gene Name

insulin-like growth factor 2 receptor

Synonyms

M6P/IGF2R, IGF-II/CI-MPR, Mpr300, CI-MPR, CD222, mannose-6-phosphate receptor, cation independent

MMRRC Submission

039868-MU

Accession Numbers

Genbank: NM_010515.2; Ensembl: ENSMUST00000024599, ENSMUST00000162982, ENSMUST00000159127

Essential gene?

Probably essential (E-score: 0.875) question?

Stock #

R1843 (G1)

Quality Score

203

Status

Not validated

Chromosome

Chromosomal Location

12682406-12769664 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 12704270 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000024599 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024599] [ENSMUST00000024599]

AlphaFold

Q07113

Predicted Effect

probably null
Transcript: ENSMUST00000024599

SMART Domains

Protein: ENSMUSP00000024599
Gene: ENSMUSG00000023830

Domain	Start	End	E-Value	Type
signal peptide	1	35	N/A	INTRINSIC
low complexity region	94	104	N/A	INTRINSIC
Pfam:CIMR	118	266	5.1e-21	PFAM
Pfam:CIMR	272	416	8.8e-22	PFAM
Pfam:CIMR	418	567	3.4e-53	PFAM
Pfam:CIMR	569	709	6.5e-47	PFAM
Pfam:CIMR	713	869	6.5e-34	PFAM
Pfam:CIMR	876	1020	1.9e-10	PFAM
Pfam:CIMR	1024	1171	1e-60	PFAM
Pfam:CIMR	1172	1313	1.2e-17	PFAM
Pfam:CIMR	1315	1455	2.1e-58	PFAM
Pfam:CIMR	1458	1592	1.8e-22	PFAM
Pfam:CIMR	1596	1743	9.1e-23	PFAM
Pfam:CIMR	1748	1887	2.5e-22	PFAM
FN2	1889	1935	9.51e-26	SMART
Pfam:CIMR	1939	2076	2.1e-22	PFAM
Pfam:CIMR	2230	2294	4.9e-9	PFAM
transmembrane domain	2295	2317	N/A	INTRINSIC
low complexity region	2336	2363	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000024599

SMART Domains

Protein: ENSMUSP00000024599
Gene: ENSMUSG00000023830

Domain	Start	End	E-Value	Type
signal peptide	1	35	N/A	INTRINSIC
low complexity region	94	104	N/A	INTRINSIC
Pfam:CIMR	118	266	5.1e-21	PFAM
Pfam:CIMR	272	416	8.8e-22	PFAM
Pfam:CIMR	418	567	3.4e-53	PFAM
Pfam:CIMR	569	709	6.5e-47	PFAM
Pfam:CIMR	713	869	6.5e-34	PFAM
Pfam:CIMR	876	1020	1.9e-10	PFAM
Pfam:CIMR	1024	1171	1e-60	PFAM
Pfam:CIMR	1172	1313	1.2e-17	PFAM
Pfam:CIMR	1315	1455	2.1e-58	PFAM
Pfam:CIMR	1458	1592	1.8e-22	PFAM
Pfam:CIMR	1596	1743	9.1e-23	PFAM
Pfam:CIMR	1748	1887	2.5e-22	PFAM
FN2	1889	1935	9.51e-26	SMART
Pfam:CIMR	1939	2076	2.1e-22	PFAM
Pfam:CIMR	2230	2294	4.9e-9	PFAM
transmembrane domain	2295	2317	N/A	INTRINSIC
low complexity region	2336	2363	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161738

SMART Domains

Protein: ENSMUSP00000124664
Gene: ENSMUSG00000023830

Domain	Start	End	E-Value	Type
Pfam:CIMR	1	65	3.1e-24	PFAM
Pfam:CIMR	68	129	6.1e-15	PFAM

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.3%
20x: 92.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for both insulin-like growth factor 2 and mannose 6-phosphate. The binding sites for each ligand are located on different segments of the protein. This receptor has various functions, including in the intracellular trafficking of lysosomal enzymes, the activation of transforming growth factor beta, and the degradation of insulin-like growth factor 2. Mutation or loss of heterozygosity of this gene has been association with risk of hepatocellular carcinoma. The orthologous mouse gene is imprinted and shows exclusive expression from the maternal allele; however, imprinting of the human gene may be polymorphic, as only a minority of individuals showed biased expression from the maternal allele (PMID:8267611). [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutants inheriting maternally a targeted disruption of this gene exhibit elevated serum and tissue IGF-II levels, overgrowth, organomegaly, kinky tail, polydactyly, heart defects, edema, dyspnea, imperforate vagina, reduced fertility and perinatal death.Survival is influenced by genetic background. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(6)

Other mutations in this stock

Total: 102 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933405L10Rik	C	T	8: 105,708,974	T88M	probably damaging	Het
9130011E15Rik	A	C	19: 45,975,252	S42R	probably benign	Het
9430038I01Rik	A	G	7: 137,377,066		probably benign	Het
Adgra3	A	C	5: 49,961,492	S905A	probably damaging	Het
Adgrv1	A	G	13: 81,544,533	Y1618H	probably damaging	Het
Anapc15-ps	T	C	10: 95,673,314	T26A	probably benign	Het
Ankrd13d	T	C	19: 4,271,595	K360E	probably damaging	Het
Anks1b	T	A	10: 90,512,889		probably null	Het
Apob	T	C	12: 8,007,602	F2028S	possibly damaging	Het
Arap3	G	A	18: 37,975,583	R1265W	probably damaging	Het
Arhgef37	A	G	18: 61,518,050	Y135H	probably damaging	Het
Atp1a1	T	C	3: 101,582,017	T760A	probably benign	Het
Cdc42bpb	T	A	12: 111,322,821	M497L	probably benign	Het
Ces5a	C	T	8: 93,514,231	V413M	probably damaging	Het
Chd5	A	T	4: 152,385,806	Y1903F	probably damaging	Het
Chd9	T	A	8: 91,010,794	N1500K	probably benign	Het
Chmp7	G	T	14: 69,719,799	D303E	probably benign	Het
Chrnb4	A	T	9: 55,034,818	Y391N	possibly damaging	Het
Crtc1	T	C	8: 70,388,152	T475A	probably benign	Het
Cyp2c69	A	G	19: 39,877,528	I207T	probably benign	Het
Dcp1a	A	G	14: 30,518,983	E250G	probably damaging	Het
Ddx20	T	C	3: 105,679,082	Q649R	probably benign	Het
Defb12	T	A	8: 19,112,738	K59N	probably damaging	Het
Dpy19l3	A	T	7: 35,729,760	I85N	probably damaging	Het
Duox2	C	T	2: 122,292,258		probably null	Het
E430018J23Rik	A	C	7: 127,391,488	D442E	probably benign	Het
Ebi3	T	A	17: 55,956,679	Y197N	probably damaging	Het
Emc1	G	A	4: 139,375,512	R994Q	probably benign	Het
Ercc6	G	T	14: 32,546,820	M530I	probably damaging	Het
Evl	T	A	12: 108,652,996	D70E	probably damaging	Het
Fam35a	A	G	14: 34,267,803	I382T	probably benign	Het
Fbln2	A	G	6: 91,265,775	N819S	probably damaging	Het
Foxk2	A	G	11: 121,285,537	I170V	probably benign	Het
Gfm1	T	C	3: 67,435,610	V159A	probably damaging	Het
Gm10837	A	G	14: 122,490,765	T18A	unknown	Het
Gm12887	A	T	4: 121,622,030	V25E	probably damaging	Het
Hectd4	A	G	5: 121,297,180	H985R	possibly damaging	Het
Hsfy2	A	G	1: 56,636,632	Y249H	possibly damaging	Het
Hspg2	T	C	4: 137,545,567	V2639A	probably damaging	Het
Invs	T	A	4: 48,422,035	I889N	probably damaging	Het
Kcnq1	A	T	7: 143,183,120	M209L	probably benign	Het
Klra7	A	G	6: 130,229,994	I48T	possibly damaging	Het
Krt26	CTAGTA	CTA	11: 99,333,526		probably benign	Het
Lrif1	T	A	3: 106,732,811	V404D	probably damaging	Het
Lrriq1	T	A	10: 103,227,173		probably null	Het
Lypd6	T	A	2: 50,188,762	I90N	possibly damaging	Het
Mbp	A	G	18: 82,584,122	D174G	probably damaging	Het
Megf9	G	T	4: 70,534,785	P13Q	probably damaging	Het
Myo15b	A	T	11: 115,869,586	T1155S	probably benign	Het
Nlrp6	T	A	7: 140,923,093	C371S	probably damaging	Het
Nosip	T	A	7: 45,077,309		probably null	Het
Nox3	G	T	17: 3,669,878	P344H	probably damaging	Het
Nup210l	T	C	3: 90,172,086	V959A	probably damaging	Het
Olfr1360	C	A	13: 21,674,672	V91L	probably benign	Het
Olfr1475	A	G	19: 13,479,931	I89T	probably benign	Het
Olfr175-ps1	T	A	16: 58,824,077	I211F	probably damaging	Het
Olfr267	T	C	4: 58,785,384	I113V	probably benign	Het
Olfr959	A	G	9: 39,572,735	Y175H	possibly damaging	Het
Osbpl3	A	C	6: 50,370,143	S25A	probably damaging	Het
Otog	G	A	7: 46,246,283	C107Y	probably damaging	Het
Pax7	G	A	4: 139,784,491	R260C	probably damaging	Het
Pbrm1	A	T	14: 31,038,957	I224F	probably damaging	Het
Pcdh1	T	A	18: 38,192,225		probably null	Het
Pcnx	T	C	12: 81,980,935	L1585P	probably damaging	Het
Pde4c	C	T	8: 70,747,950	H362Y	probably damaging	Het
Pdlim2	C	T	14: 70,164,779	R296H	probably damaging	Het
Pgm2	A	T	4: 99,961,478	Q90L	probably damaging	Het
Phlpp1	A	G	1: 106,343,505	H814R	probably benign	Het
Pknox2	A	T	9: 36,954,831	M5K	possibly damaging	Het
Pole	G	A	5: 110,330,835		probably null	Het
Polr1b	A	G	2: 129,102,966	I61V	probably benign	Het
Prelp	T	C	1: 133,914,757	K217E	probably damaging	Het
Prkce	C	T	17: 86,475,546	Q202*	probably null	Het
Psmd2	T	G	16: 20,656,582	M370R	probably benign	Het
Rimklb	A	T	6: 122,464,009	H68Q	probably damaging	Het
Rnasel	A	G	1: 153,754,674	D312G	possibly damaging	Het
Rxrg	A	T	1: 167,598,752	M1L	probably benign	Het
Scrn1	A	G	6: 54,522,841	F220L	possibly damaging	Het
Scyl3	A	G	1: 163,950,675	S461G	probably benign	Het
Serpina1c	T	A	12: 103,895,023	T411S	probably benign	Het
Serpinb6d	C	T	13: 33,671,381	P346L	probably benign	Het
Slc9a3r2	C	T	17: 24,641,719	S150N	possibly damaging	Het
Spg21	G	T	9: 65,465,336	V17F	probably damaging	Het
Spink5	A	T	18: 43,999,891	M525L	probably benign	Het
Sun2	T	C	15: 79,737,563	T155A	probably benign	Het
Tchh	T	A	3: 93,446,780	F1176I	unknown	Het
Tex15	T	A	8: 33,576,654	D2037E	probably benign	Het
Tfdp2	T	C	9: 96,317,804	C392R	possibly damaging	Het
Tmem30c	T	C	16: 57,276,780	N139S	probably benign	Het
Tns2	C	T	15: 102,113,133		probably null	Het
Trim66	T	C	7: 109,475,839	E405G	probably damaging	Het
Trpc4	T	A	3: 54,279,994	F456I	probably benign	Het
Tspo2	T	C	17: 48,448,790	D108G	possibly damaging	Het
Tyk2	A	T	9: 21,121,554	C304*	probably null	Het
Vgll4	A	T	6: 114,862,795	S185T	probably benign	Het
Vmn2r94	A	C	17: 18,244,470	S519R	probably benign	Het
Vmn2r96	T	G	17: 18,597,921	S587A	probably benign	Het
Vps4b	C	A	1: 106,778,982	A287S	possibly damaging	Het
Yeats2	C	T	16: 20,229,564	P1332S	probably benign	Het
Zfp462	T	G	4: 55,010,010	S659A	possibly damaging	Het
Zfp507	C	T	7: 35,793,725	R631Q	probably damaging	Het
Zswim5	G	T	4: 116,877,699	E80D	unknown	Het

Other mutations in Igf2r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Igf2r	APN	17	12713990	missense	probably benign	0.01
IGL00534:Igf2r	APN	17	12739328	missense	probably damaging	0.97
IGL00902:Igf2r	APN	17	12700358	missense	probably damaging	0.99
IGL00903:Igf2r	APN	17	12683867	missense	possibly damaging	0.70
IGL01160:Igf2r	APN	17	12704775	missense	possibly damaging	0.73
IGL01380:Igf2r	APN	17	12695374	missense	probably benign	0.01
IGL01392:Igf2r	APN	17	12704349	missense	probably benign
IGL01557:Igf2r	APN	17	12704635	missense	possibly damaging	0.82
IGL01568:Igf2r	APN	17	12683985	missense	possibly damaging	0.93
IGL01611:Igf2r	APN	17	12725415	nonsense	probably null
IGL01720:Igf2r	APN	17	12701313	missense	probably damaging	0.99
IGL01756:Igf2r	APN	17	12683822	missense	probably benign
IGL01839:Igf2r	APN	17	12705022	missense	probably damaging	1.00
IGL01904:Igf2r	APN	17	12714911	missense	probably damaging	0.99
IGL01965:Igf2r	APN	17	12704338	missense	probably benign	0.12
IGL02083:Igf2r	APN	17	12693192	nonsense	probably null
IGL02095:Igf2r	APN	17	12702005	missense	probably damaging	0.99
IGL02183:Igf2r	APN	17	12698516	unclassified	probably benign
IGL02576:Igf2r	APN	17	12748763	missense	possibly damaging	0.90
IGL02649:Igf2r	APN	17	12712087	missense	possibly damaging	0.93
IGL02807:Igf2r	APN	17	12719883	missense	probably damaging	0.98
IGL02833:Igf2r	APN	17	12692723	missense	probably damaging	0.97
IGL02885:Igf2r	APN	17	12694120	missense	possibly damaging	0.94
IGL02990:Igf2r	APN	17	12710746	splice site	probably benign
IGL03080:Igf2r	APN	17	12726676	missense	probably benign	0.06
IGL03176:Igf2r	APN	17	12716672	missense	probably damaging	1.00
blunt	UTSW	17	12722175	missense	probably benign	0.02
brusque	UTSW	17	12714951	missense	probably damaging	0.98
gruff	UTSW	17	12684097	missense	probably damaging	0.96
outlier	UTSW	17	12695314	missense	probably benign	0.20
NA:Igf2r	UTSW	17	12691962	missense	probably benign
R0165:Igf2r	UTSW	17	12698527	missense	probably benign	0.07
R0412:Igf2r	UTSW	17	12683948	missense	probably damaging	0.98
R0523:Igf2r	UTSW	17	12692064	missense	probably benign	0.27
R0631:Igf2r	UTSW	17	12717274	splice site	probably null
R0722:Igf2r	UTSW	17	12715495	critical splice acceptor site	probably null
R0894:Igf2r	UTSW	17	12692101	missense	probably benign	0.02
R1265:Igf2r	UTSW	17	12694124	missense	probably damaging	0.98
R1466:Igf2r	UTSW	17	12717269	splice site	probably benign
R1485:Igf2r	UTSW	17	12691285	missense	probably damaging	1.00
R1633:Igf2r	UTSW	17	12726309	missense	probably benign
R1693:Igf2r	UTSW	17	12704316	missense	probably damaging	0.97
R1751:Igf2r	UTSW	17	12697441	missense	possibly damaging	0.94
R1981:Igf2r	UTSW	17	12733903	nonsense	probably null
R1994:Igf2r	UTSW	17	12692738	missense	probably benign
R2060:Igf2r	UTSW	17	12701319	missense	possibly damaging	0.92
R2108:Igf2r	UTSW	17	12698251	missense	probably benign	0.02
R2132:Igf2r	UTSW	17	12722208	missense	probably benign	0.12
R2314:Igf2r	UTSW	17	12715943	missense	probably benign	0.28
R2349:Igf2r	UTSW	17	12722311	splice site	probably null
R2696:Igf2r	UTSW	17	12695344	missense	possibly damaging	0.96
R2864:Igf2r	UTSW	17	12686724	missense	probably damaging	0.99
R2865:Igf2r	UTSW	17	12686724	missense	probably damaging	0.99
R3884:Igf2r	UTSW	17	12709468	missense	probably benign
R3930:Igf2r	UTSW	17	12705829	missense	probably benign	0.01
R4021:Igf2r	UTSW	17	12748751	missense	probably damaging	0.97
R4125:Igf2r	UTSW	17	12702254	missense	possibly damaging	0.93
R4342:Igf2r	UTSW	17	12709511	missense	possibly damaging	0.95
R4343:Igf2r	UTSW	17	12709511	missense	possibly damaging	0.95
R4345:Igf2r	UTSW	17	12709511	missense	possibly damaging	0.95
R4760:Igf2r	UTSW	17	12703465	missense	possibly damaging	0.92
R4796:Igf2r	UTSW	17	12684126	missense	possibly damaging	0.70
R4816:Igf2r	UTSW	17	12684097	missense	probably damaging	0.96
R4826:Igf2r	UTSW	17	12701353	missense	probably damaging	0.98
R4933:Igf2r	UTSW	17	12691877	splice site	probably null
R4980:Igf2r	UTSW	17	12703360	critical splice donor site	probably null
R5389:Igf2r	UTSW	17	12725416	missense	probably damaging	1.00
R5473:Igf2r	UTSW	17	12695314	missense	probably benign	0.20
R5494:Igf2r	UTSW	17	12693145	missense	possibly damaging	0.74
R5619:Igf2r	UTSW	17	12739334	missense	probably damaging	1.00
R5738:Igf2r	UTSW	17	12717367	missense	probably benign	0.23
R5761:Igf2r	UTSW	17	12698352	splice site	probably null
R5794:Igf2r	UTSW	17	12709445	missense	probably benign	0.37
R6210:Igf2r	UTSW	17	12714951	missense	probably damaging	0.98
R6319:Igf2r	UTSW	17	12714113	missense	probably damaging	1.00
R6388:Igf2r	UTSW	17	12683900	missense	probably benign
R6396:Igf2r	UTSW	17	12714090	missense	probably benign	0.00
R6584:Igf2r	UTSW	17	12701250	missense	probably damaging	0.99
R6590:Igf2r	UTSW	17	12691937	nonsense	probably null
R6591:Igf2r	UTSW	17	12689008	missense	probably damaging	1.00
R6599:Igf2r	UTSW	17	12698618	missense	possibly damaging	0.85
R6690:Igf2r	UTSW	17	12691937	nonsense	probably null
R6691:Igf2r	UTSW	17	12689008	missense	probably damaging	1.00
R6752:Igf2r	UTSW	17	12714944	missense	probably damaging	1.00
R6816:Igf2r	UTSW	17	12714082	missense	probably damaging	0.99
R6841:Igf2r	UTSW	17	12703376	missense	probably damaging	0.97
R6877:Igf2r	UTSW	17	12697341	missense	probably damaging	0.97
R6950:Igf2r	UTSW	17	12718718	missense	probably benign
R7030:Igf2r	UTSW	17	12733866	missense	probably damaging	1.00
R7038:Igf2r	UTSW	17	12698325	missense	probably benign	0.23
R7055:Igf2r	UTSW	17	12704323	missense	probably damaging	0.99
R7074:Igf2r	UTSW	17	12714116	missense	possibly damaging	0.57
R7348:Igf2r	UTSW	17	12703484	missense	probably damaging	0.99
R7413:Igf2r	UTSW	17	12698228	nonsense	probably null
R7463:Igf2r	UTSW	17	12710645	missense	probably benign	0.16
R7619:Igf2r	UTSW	17	12698273	missense	possibly damaging	0.88
R7730:Igf2r	UTSW	17	12735991	missense	probably damaging	0.98
R7733:Igf2r	UTSW	17	12739369	missense	possibly damaging	0.90
R7881:Igf2r	UTSW	17	12748704	missense	probably benign
R8022:Igf2r	UTSW	17	12718795	missense	probably damaging	1.00
R8138:Igf2r	UTSW	17	12701238	missense	probably benign	0.32
R8220:Igf2r	UTSW	17	12692071	missense	probably benign	0.22
R8305:Igf2r	UTSW	17	12733860	missense	probably benign
R8359:Igf2r	UTSW	17	12683861	missense	probably benign
R8500:Igf2r	UTSW	17	12709441	missense	probably damaging	0.99
R8510:Igf2r	UTSW	17	12704313	missense	probably benign	0.38
R8933:Igf2r	UTSW	17	12701244	missense	probably damaging	0.97
R8933:Igf2r	UTSW	17	12704637	missense	probably damaging	1.00
R8976:Igf2r	UTSW	17	12726772	missense	probably damaging	1.00
R8994:Igf2r	UTSW	17	12716650	missense	possibly damaging	0.87
R9059:Igf2r	UTSW	17	12751293	start codon destroyed	probably null
R9097:Igf2r	UTSW	17	12691213	missense	probably damaging	1.00
R9127:Igf2r	UTSW	17	12739351	missense	probably damaging	0.98
R9278:Igf2r	UTSW	17	12695353	missense	probably damaging	1.00
R9362:Igf2r	UTSW	17	12722175	missense	probably benign	0.02
R9371:Igf2r	UTSW	17	12705759	missense	possibly damaging	0.93
R9522:Igf2r	UTSW	17	12698328	missense	probably benign	0.26
R9567:Igf2r	UTSW	17	12686754	missense	probably damaging	1.00
R9665:Igf2r	UTSW	17	12694140	missense	probably benign	0.17
R9666:Igf2r	UTSW	17	12726701	missense	probably benign
X0028:Igf2r	UTSW	17	12704913	nonsense	probably null
Z1177:Igf2r	UTSW	17	12697399	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CTGACTGCTTTACTGGTTTCAAG -3'
(R):5'- TTGGCTTAAGCGAGCGAGAG -3'

Sequencing Primer
(F):5'- CAATCCAAGTATATTAGAGAAAGGCC -3'
(R):5'- CGAGAGACTGGAGACTTCCTG -3'

Posted On

2014-06-23