Incidental Mutation 'R1843:Mbp'
ID207494
Institutional Source Beutler Lab
Gene Symbol Mbp
Ensembl Gene ENSMUSG00000041607
Gene Namemyelin basic protein
Synonymsgolli-mbp, Hmbpr
MMRRC Submission 039868-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.294) question?
Stock #R1843 (G1)
Quality Score217
Status Not validated
Chromosome18
Chromosomal Location82475146-82585637 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82584122 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 174 (D174G)
Ref Sequence ENSEMBL: ENSMUSP00000110322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047865] [ENSMUST00000062446] [ENSMUST00000075372] [ENSMUST00000080658] [ENSMUST00000102812] [ENSMUST00000114674] [ENSMUST00000132369] [ENSMUST00000143506]
Predicted Effect probably damaging
Transcript: ENSMUST00000047865
AA Change: D240G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046185
Gene: ENSMUSG00000041607
AA Change: D240G

DomainStartEndE-ValueType
Pfam:Myelin_MBP 147 241 2.7e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000062446
AA Change: D185G

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000053495
Gene: ENSMUSG00000041607
AA Change: D185G

DomainStartEndE-ValueType
Pfam:Myelin_MBP 14 84 6.7e-25 PFAM
Pfam:Myelin_MBP 79 195 6.9e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000075372
AA Change: D148G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000074836
Gene: ENSMUSG00000041607
AA Change: D148G

DomainStartEndE-ValueType
Pfam:Myelin_MBP 14 158 8.1e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000080658
AA Change: D144G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000079488
Gene: ENSMUSG00000041607
AA Change: D144G

DomainStartEndE-ValueType
Pfam:Myelin_MBP 14 85 4.1e-25 PFAM
Pfam:Myelin_MBP 81 154 3.5e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102812
AA Change: D159G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099876
Gene: ENSMUSG00000041607
AA Change: D159G

DomainStartEndE-ValueType
Pfam:Myelin_MBP 14 169 1.7e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114674
AA Change: D174G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110322
Gene: ENSMUSG00000041607
AA Change: D174G

DomainStartEndE-ValueType
Pfam:Myelin_MBP 14 85 6.3e-25 PFAM
Pfam:Myelin_MBP 79 184 1.3e-19 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000123251
AA Change: D201G
SMART Domains Protein: ENSMUSP00000121855
Gene: ENSMUSG00000041607
AA Change: D201G

DomainStartEndE-ValueType
Pfam:Myelin_MBP 31 212 1.4e-72 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000132369
AA Change: D147G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114230
Gene: ENSMUSG00000041607
AA Change: D147G

DomainStartEndE-ValueType
Pfam:Myelin_MBP 13 157 5.2e-45 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000133193
AA Change: D139G
SMART Domains Protein: ENSMUSP00000116019
Gene: ENSMUSG00000041607
AA Change: D139G

DomainStartEndE-ValueType
Pfam:Myelin_MBP 36 150 4.6e-52 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000142850
AA Change: D182G
SMART Domains Protein: ENSMUSP00000115082
Gene: ENSMUSG00000041607
AA Change: D182G

DomainStartEndE-ValueType
Pfam:Myelin_MBP 38 193 7.9e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143506
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150952
Predicted Effect unknown
Transcript: ENSMUST00000152071
AA Change: D180G
SMART Domains Protein: ENSMUSP00000115409
Gene: ENSMUSG00000041607
AA Change: D180G

DomainStartEndE-ValueType
Pfam:Myelin_MBP 51 191 2.7e-47 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000153478
AA Change: D185G
SMART Domains Protein: ENSMUSP00000114630
Gene: ENSMUSG00000041607
AA Change: D185G

DomainStartEndE-ValueType
Pfam:Myelin_MBP 26 196 6.2e-63 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by the classic Mbp gene is a major constituent of the myelin sheath of oligodendrocytes and Schwann cells in the nervous system. However, Mbp-related transcripts are also present in the bone marrow and the immune system. These mRNAs arise from the long Mbp gene (otherwise called "Golli-Mbp") that contains 3 additional exons located upstream of the classic Mbp exons. Alternative splicing from the Golli and the Mbp transcription start sites gives rise to 2 sets of Mbp-related transcripts and gene products. The Golli mRNAs contain 3 exons unique to Golli-Mbp, spliced in-frame to 1 or more Mbp exons. They encode hybrid proteins that have N-terminal Golli aa sequence linked to Mbp aa sequence. The second family of transcripts contain only Mbp exons and produce the well characterized myelin basic proteins. This complex gene structure is conserved among species suggesting that the Mbp transcription unit is an integral part of the Golli transcription unit and that this arrangement is important for the function and/or regulation of these genes. Mutation of the Mbp gene is associated with the 'shiverer' and 'myelin deficient' phenotypes in mouse. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele show altered myelination, oligodendrocytes, Ca2+ responses, and visual-evoked potentials. Spontaneous mutations cause dymyelination, tremors and ataxia, and may alter survival, susceptibility to seizures, viral infection and EAE, and hearing or vestibular function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik C T 8: 105,708,974 T88M probably damaging Het
9130011E15Rik A C 19: 45,975,252 S42R probably benign Het
9430038I01Rik A G 7: 137,377,066 probably benign Het
Adgra3 A C 5: 49,961,492 S905A probably damaging Het
Adgrv1 A G 13: 81,544,533 Y1618H probably damaging Het
Anapc15-ps T C 10: 95,673,314 T26A probably benign Het
Ankrd13d T C 19: 4,271,595 K360E probably damaging Het
Anks1b T A 10: 90,512,889 probably null Het
Apob T C 12: 8,007,602 F2028S possibly damaging Het
Arap3 G A 18: 37,975,583 R1265W probably damaging Het
Arhgef37 A G 18: 61,518,050 Y135H probably damaging Het
Atp1a1 T C 3: 101,582,017 T760A probably benign Het
Cdc42bpb T A 12: 111,322,821 M497L probably benign Het
Ces5a C T 8: 93,514,231 V413M probably damaging Het
Chd5 A T 4: 152,385,806 Y1903F probably damaging Het
Chd9 T A 8: 91,010,794 N1500K probably benign Het
Chmp7 G T 14: 69,719,799 D303E probably benign Het
Chrnb4 A T 9: 55,034,818 Y391N possibly damaging Het
Crtc1 T C 8: 70,388,152 T475A probably benign Het
Cyp2c69 A G 19: 39,877,528 I207T probably benign Het
Dcp1a A G 14: 30,518,983 E250G probably damaging Het
Ddx20 T C 3: 105,679,082 Q649R probably benign Het
Defb12 T A 8: 19,112,738 K59N probably damaging Het
Dpy19l3 A T 7: 35,729,760 I85N probably damaging Het
Duox2 C T 2: 122,292,258 probably null Het
E430018J23Rik A C 7: 127,391,488 D442E probably benign Het
Ebi3 T A 17: 55,956,679 Y197N probably damaging Het
Emc1 G A 4: 139,375,512 R994Q probably benign Het
Ercc6 G T 14: 32,546,820 M530I probably damaging Het
Evl T A 12: 108,652,996 D70E probably damaging Het
Fam35a A G 14: 34,267,803 I382T probably benign Het
Fbln2 A G 6: 91,265,775 N819S probably damaging Het
Foxk2 A G 11: 121,285,537 I170V probably benign Het
Gfm1 T C 3: 67,435,610 V159A probably damaging Het
Gm10837 A G 14: 122,490,765 T18A unknown Het
Gm12887 A T 4: 121,622,030 V25E probably damaging Het
Hectd4 A G 5: 121,297,180 H985R possibly damaging Het
Hsfy2 A G 1: 56,636,632 Y249H possibly damaging Het
Hspg2 T C 4: 137,545,567 V2639A probably damaging Het
Igf2r A G 17: 12,704,270 probably null Het
Invs T A 4: 48,422,035 I889N probably damaging Het
Kcnq1 A T 7: 143,183,120 M209L probably benign Het
Klra7 A G 6: 130,229,994 I48T possibly damaging Het
Krt26 CTAGTA CTA 11: 99,333,526 probably benign Het
Lrif1 T A 3: 106,732,811 V404D probably damaging Het
Lrriq1 T A 10: 103,227,173 probably null Het
Lypd6 T A 2: 50,188,762 I90N possibly damaging Het
Megf9 G T 4: 70,534,785 P13Q probably damaging Het
Myo15b A T 11: 115,869,586 T1155S probably benign Het
Nlrp6 T A 7: 140,923,093 C371S probably damaging Het
Nosip T A 7: 45,077,309 probably null Het
Nox3 G T 17: 3,669,878 P344H probably damaging Het
Nup210l T C 3: 90,172,086 V959A probably damaging Het
Olfr1360 C A 13: 21,674,672 V91L probably benign Het
Olfr1475 A G 19: 13,479,931 I89T probably benign Het
Olfr175-ps1 T A 16: 58,824,077 I211F probably damaging Het
Olfr267 T C 4: 58,785,384 I113V probably benign Het
Olfr959 A G 9: 39,572,735 Y175H possibly damaging Het
Osbpl3 A C 6: 50,370,143 S25A probably damaging Het
Otog G A 7: 46,246,283 C107Y probably damaging Het
Pax7 G A 4: 139,784,491 R260C probably damaging Het
Pbrm1 A T 14: 31,038,957 I224F probably damaging Het
Pcdh1 T A 18: 38,192,225 probably null Het
Pcnx T C 12: 81,980,935 L1585P probably damaging Het
Pde4c C T 8: 70,747,950 H362Y probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pgm2 A T 4: 99,961,478 Q90L probably damaging Het
Phlpp1 A G 1: 106,343,505 H814R probably benign Het
Pknox2 A T 9: 36,954,831 M5K possibly damaging Het
Pole G A 5: 110,330,835 probably null Het
Polr1b A G 2: 129,102,966 I61V probably benign Het
Prelp T C 1: 133,914,757 K217E probably damaging Het
Prkce C T 17: 86,475,546 Q202* probably null Het
Psmd2 T G 16: 20,656,582 M370R probably benign Het
Rimklb A T 6: 122,464,009 H68Q probably damaging Het
Rnasel A G 1: 153,754,674 D312G possibly damaging Het
Rxrg A T 1: 167,598,752 M1L probably benign Het
Scrn1 A G 6: 54,522,841 F220L possibly damaging Het
Scyl3 A G 1: 163,950,675 S461G probably benign Het
Serpina1c T A 12: 103,895,023 T411S probably benign Het
Serpinb6d C T 13: 33,671,381 P346L probably benign Het
Slc9a3r2 C T 17: 24,641,719 S150N possibly damaging Het
Spg21 G T 9: 65,465,336 V17F probably damaging Het
Spink5 A T 18: 43,999,891 M525L probably benign Het
Sun2 T C 15: 79,737,563 T155A probably benign Het
Tchh T A 3: 93,446,780 F1176I unknown Het
Tex15 T A 8: 33,576,654 D2037E probably benign Het
Tfdp2 T C 9: 96,317,804 C392R possibly damaging Het
Tmem30c T C 16: 57,276,780 N139S probably benign Het
Tns2 C T 15: 102,113,133 probably null Het
Trim66 T C 7: 109,475,839 E405G probably damaging Het
Trpc4 T A 3: 54,279,994 F456I probably benign Het
Tspo2 T C 17: 48,448,790 D108G possibly damaging Het
Tyk2 A T 9: 21,121,554 C304* probably null Het
Vgll4 A T 6: 114,862,795 S185T probably benign Het
Vmn2r94 A C 17: 18,244,470 S519R probably benign Het
Vmn2r96 T G 17: 18,597,921 S587A probably benign Het
Vps4b C A 1: 106,778,982 A287S possibly damaging Het
Yeats2 C T 16: 20,229,564 P1332S probably benign Het
Zfp462 T G 4: 55,010,010 S659A possibly damaging Het
Zfp507 C T 7: 35,793,725 R631Q probably damaging Het
Zswim5 G T 4: 116,877,699 E80D unknown Het
Other mutations in Mbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02176:Mbp APN 18 82554545 missense probably damaging 1.00
IGL02667:Mbp APN 18 82554615 missense probably damaging 1.00
R0501:Mbp UTSW 18 82575197 missense probably damaging 0.98
R0628:Mbp UTSW 18 82554617 missense probably damaging 1.00
R0883:Mbp UTSW 18 82572870 missense probably damaging 1.00
R1791:Mbp UTSW 18 82554349 missense probably benign 0.00
R7453:Mbp UTSW 18 82554643 missense probably damaging 1.00
R7651:Mbp UTSW 18 82554374 missense probably damaging 1.00
Z1177:Mbp UTSW 18 82513010 missense unknown
Z1177:Mbp UTSW 18 82561845 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TCCACTTAGGGCTTTCTGCAG -3'
(R):5'- AATAGTTTTAACCAGTCGGGGTG -3'

Sequencing Primer
(F):5'- CTGCAGGCGGTGTGACAAATC -3'
(R):5'- CCAGTCGGGGTGCCGTG -3'
Posted On2014-06-23