Incidental Mutation 'R1844:Plekhm2'
ID207525
Institutional Source Beutler Lab
Gene Symbol Plekhm2
Ensembl Gene ENSMUSG00000028917
Gene Namepleckstrin homology domain containing, family M (with RUN domain) member 2
Synonyms2310034J19Rik
MMRRC Submission 039869-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1844 (G1)
Quality Score221
Status Not validated
Chromosome4
Chromosomal Location141625734-141664899 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141632374 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 381 (T381A)
Ref Sequence ENSEMBL: ENSMUSP00000081221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030751] [ENSMUST00000084203]
Predicted Effect probably benign
Transcript: ENSMUST00000030751
AA Change: T361A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030751
Gene: ENSMUSG00000028917
AA Change: T361A

DomainStartEndE-ValueType
RUN 93 156 3.18e-21 SMART
low complexity region 230 246 N/A INTRINSIC
low complexity region 295 307 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
low complexity region 485 495 N/A INTRINSIC
low complexity region 505 538 N/A INTRINSIC
Blast:PH 596 656 7e-31 BLAST
PH 766 869 2.43e-12 SMART
Blast:PH 879 960 6e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000084203
AA Change: T381A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000081221
Gene: ENSMUSG00000028917
AA Change: T381A

DomainStartEndE-ValueType
RUN 93 156 3.18e-21 SMART
low complexity region 250 266 N/A INTRINSIC
low complexity region 315 327 N/A INTRINSIC
low complexity region 479 489 N/A INTRINSIC
low complexity region 505 515 N/A INTRINSIC
low complexity region 525 558 N/A INTRINSIC
Blast:PH 616 676 7e-31 BLAST
PH 786 889 2.43e-12 SMART
Blast:PH 899 980 6e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136102
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140223
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150229
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds the plus-end directed microtubule motor protein kinesin, together with the lysosomal GTPase Arl8, and is required for lysosomes to distribute away from the microtubule-organizing center. The encoded protein belongs to the multisubunit BLOC-one-related complex that regulates lysosome positioning. It binds a Salmonella effector protein called Salmonella induced filament A and is a critical host determinant in Salmonella pathogenesis. It has a domain architecture consisting of an N-terminal RPIP8, UNC-14, and NESCA (RUN) domain that binds kinesin-1 as well as the lysosomal GTPase Arl8, and a C-terminal pleckstrin homology domain that binds the Salmonella induced filament A effector protein. Naturally occurring mutations in this gene lead to abnormal localization of lysosomes, impaired autophagy flux and are associated with recessive dilated cardiomyopathy and left ventricular noncompaction. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased leukocyte numbers and decreased susceptibility to Salmonella infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik A T 7: 139,976,092 I212N probably benign Het
Aco1 A G 4: 40,197,566 K857E probably benign Het
Adam20 A G 8: 40,796,043 N397D probably benign Het
Adgrf3 T G 5: 30,199,213 D347A probably damaging Het
Ang6 C T 14: 44,001,873 E133K possibly damaging Het
Arhgap23 T A 11: 97,463,408 W205R probably damaging Het
Arhgef40 C A 14: 51,997,623 R1086S probably damaging Het
Atr G T 9: 95,905,817 A1488S probably benign Het
Cabin1 A T 10: 75,743,350 probably null Het
Cdh22 A C 2: 165,143,694 F324C probably damaging Het
Cep350 T C 1: 155,848,628 I3075V probably damaging Het
Chd9 A T 8: 90,956,695 K588* probably null Het
Clns1a A T 7: 97,696,859 I44F probably damaging Het
Colgalt1 T C 8: 71,611,351 I51T possibly damaging Het
Cpt2 C T 4: 107,904,255 E217K possibly damaging Het
Ctss A G 3: 95,546,794 probably null Het
Cyp1a1 A G 9: 57,702,697 T465A probably benign Het
Dbn1 A G 13: 55,481,347 probably null Het
Dennd1b A G 1: 139,090,405 probably null Het
Dnajc1 A C 2: 18,294,027 Y49* probably null Het
Dock10 T A 1: 80,543,201 I1188L probably damaging Het
Dsg1c T G 18: 20,283,039 probably null Het
Efcab6 G A 15: 83,967,621 T352I possibly damaging Het
Eps8l3 T C 3: 107,879,586 L26P possibly damaging Het
Fbxw26 A G 9: 109,724,878 V231A probably benign Het
Fetub G A 16: 22,935,669 E209K possibly damaging Het
Galc A T 12: 98,246,297 probably null Het
Gm6871 A T 7: 41,573,468 N65K probably benign Het
Gm8857 T C 5: 10,949,027 probably benign Het
Gstp3 A G 19: 4,057,540 I208T probably benign Het
Gtpbp3 A G 8: 71,492,628 Y448C probably benign Het
Hdac7 G T 15: 97,807,976 Q385K probably damaging Het
Hemgn C T 4: 46,396,655 V194M possibly damaging Het
Idh2 G C 7: 80,098,877 T113R probably benign Het
Jarid2 A C 13: 44,902,743 K336T possibly damaging Het
Kcnj4 C T 15: 79,485,015 V255M probably damaging Het
Ldhb C A 6: 142,494,208 W202L probably damaging Het
Lmbrd2 T A 15: 9,177,751 Y512* probably null Het
Lrp1 A G 10: 127,595,283 probably null Het
Map3k12 G A 15: 102,503,535 P365S probably damaging Het
Map3k5 G A 10: 20,104,163 D806N probably benign Het
Matn3 A G 12: 8,967,662 E438G possibly damaging Het
Mcmbp G A 7: 128,723,974 L97F probably damaging Het
Mmp3 A T 9: 7,453,662 I428L probably benign Het
Mphosph8 T C 14: 56,697,159 V855A probably damaging Het
Mycbp2 T A 14: 103,155,714 H3027L possibly damaging Het
Nbea C T 3: 56,082,436 R333H probably damaging Het
Notch1 G T 2: 26,460,434 H2231Q probably benign Het
Npas2 A T 1: 39,325,375 H266L probably damaging Het
Oas3 A G 5: 120,759,980 S833P probably damaging Het
Olfr1141 A C 2: 87,753,990 M1R probably null Het
Olfr344 T C 2: 36,568,777 Y60H probably damaging Het
Olfr808 G A 10: 129,767,856 R120H probably benign Het
Olfr994 T C 2: 85,429,921 T303A probably benign Het
Pak4 C T 7: 28,565,265 V71I possibly damaging Het
Pitpnm1 T C 19: 4,112,395 V1075A probably damaging Het
Pkp3 G A 7: 141,088,502 V555M probably damaging Het
Plppr3 A G 10: 79,866,410 probably null Het
Ppp2r5e A T 12: 75,469,766 F216I possibly damaging Het
Ppp3ca T A 3: 136,921,911 V412D probably benign Het
Prss50 A G 9: 110,858,013 probably benign Het
Psph A C 5: 129,766,468 I174R probably damaging Het
Ptov1 A G 7: 44,865,567 Y207H possibly damaging Het
Ptprs A G 17: 56,434,510 S585P probably damaging Het
Rnf146 A T 10: 29,347,724 H55Q probably damaging Het
Rnf213 T A 11: 119,441,183 M2407K probably damaging Het
Rnls A C 19: 33,202,531 L55R possibly damaging Het
Rptor T C 11: 119,756,320 C246R probably damaging Het
Rrp12 C T 19: 41,877,783 probably null Het
Samd3 A G 10: 26,251,774 D223G probably damaging Het
Sdad1 G A 5: 92,305,296 Q68* probably null Het
Selenov G A 7: 28,290,422 T219M probably damaging Het
Shd A G 17: 55,971,554 D39G possibly damaging Het
Slc26a10 A T 10: 127,178,410 V245E probably damaging Het
Slit1 A G 19: 41,625,573 L820P probably damaging Het
Snap23 T C 2: 120,590,682 F96L probably benign Het
Spert C T 14: 75,583,410 V292I probably benign Het
Stkld1 A G 2: 26,950,103 H395R probably damaging Het
Syt13 G A 2: 92,940,820 G84D probably damaging Het
Terb2 T A 2: 122,186,509 L37Q probably damaging Het
Themis A G 10: 28,781,757 Y107C probably damaging Het
Top2a T A 11: 99,016,069 T249S probably benign Het
Tspo2 A T 17: 48,449,120 F71Y probably damaging Het
Ttc21b T A 2: 66,223,577 K753* probably null Het
Ttk A G 9: 83,854,862 Y458C possibly damaging Het
Ttn T C 2: 76,755,673 R21905G probably damaging Het
Ugt3a2 T A 15: 9,351,168 F88I probably benign Het
Vmn1r119 A G 7: 21,012,196 L87P probably damaging Het
Vmn1r36 A G 6: 66,716,763 F6L probably benign Het
Vmn2r15 T A 5: 109,286,994 K615* probably null Het
Wdr18 G A 10: 79,966,727 probably null Het
Wdr6 A T 9: 108,575,977 W236R probably damaging Het
Zbtb48 T C 4: 152,026,498 T187A probably benign Het
Other mutations in Plekhm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Plekhm2 APN 4 141642645 splice site probably null
IGL01388:Plekhm2 APN 4 141642001 missense probably damaging 1.00
IGL01392:Plekhm2 APN 4 141642426 missense probably damaging 0.98
IGL01482:Plekhm2 APN 4 141630029 missense probably damaging 0.98
IGL01828:Plekhm2 APN 4 141629585 missense probably benign 0.11
IGL02010:Plekhm2 APN 4 141637419 splice site probably benign
IGL02075:Plekhm2 APN 4 141628306 missense probably benign 0.38
IGL02381:Plekhm2 APN 4 141642723 missense possibly damaging 0.95
IGL02543:Plekhm2 APN 4 141642019 missense probably benign 0.02
IGL02747:Plekhm2 APN 4 141634272 missense possibly damaging 0.55
IGL02802:Plekhm2 APN 4 141642524 splice site probably benign
IGL02828:Plekhm2 APN 4 141629630 missense probably damaging 1.00
IGL03286:Plekhm2 APN 4 141634347 missense possibly damaging 0.95
R0008:Plekhm2 UTSW 4 141642393 splice site probably benign
R0008:Plekhm2 UTSW 4 141642393 splice site probably benign
R0639:Plekhm2 UTSW 4 141642070 missense probably damaging 1.00
R0682:Plekhm2 UTSW 4 141628125 missense probably damaging 0.97
R0968:Plekhm2 UTSW 4 141629932 missense probably benign 0.01
R1109:Plekhm2 UTSW 4 141627984 missense probably benign 0.31
R1475:Plekhm2 UTSW 4 141627854 missense possibly damaging 0.75
R1802:Plekhm2 UTSW 4 141634347 missense probably benign 0.03
R1813:Plekhm2 UTSW 4 141642439 missense possibly damaging 0.93
R2261:Plekhm2 UTSW 4 141642732 missense probably damaging 0.98
R3889:Plekhm2 UTSW 4 141641990 splice site probably benign
R3922:Plekhm2 UTSW 4 141629532 missense probably benign 0.01
R4324:Plekhm2 UTSW 4 141631857 missense possibly damaging 0.86
R4758:Plekhm2 UTSW 4 141642005 missense possibly damaging 0.91
R4814:Plekhm2 UTSW 4 141627839 missense probably benign 0.00
R4983:Plekhm2 UTSW 4 141634376 missense probably damaging 1.00
R5468:Plekhm2 UTSW 4 141628100 missense probably damaging 1.00
R5691:Plekhm2 UTSW 4 141628289 missense possibly damaging 0.96
R5877:Plekhm2 UTSW 4 141639693 missense probably damaging 0.98
R6268:Plekhm2 UTSW 4 141632341 nonsense probably null
R6367:Plekhm2 UTSW 4 141639705 missense probably damaging 0.97
R6371:Plekhm2 UTSW 4 141629532 missense possibly damaging 0.94
R6489:Plekhm2 UTSW 4 141632033 missense probably damaging 1.00
R7266:Plekhm2 UTSW 4 141642459 missense possibly damaging 0.91
R7399:Plekhm2 UTSW 4 141634376 missense probably damaging 1.00
R7573:Plekhm2 UTSW 4 141631347 missense probably benign 0.02
R7742:Plekhm2 UTSW 4 141627839 missense probably benign 0.00
R7864:Plekhm2 UTSW 4 141628046 missense probably damaging 0.96
R7920:Plekhm2 UTSW 4 141632121 missense probably damaging 1.00
R8417:Plekhm2 UTSW 4 141627825 missense probably benign 0.04
R8504:Plekhm2 UTSW 4 141642453 missense probably damaging 1.00
T0722:Plekhm2 UTSW 4 141631981 small deletion probably benign
T0975:Plekhm2 UTSW 4 141631981 small deletion probably benign
X0024:Plekhm2 UTSW 4 141628041 missense probably damaging 1.00
Z1177:Plekhm2 UTSW 4 141629085 missense possibly damaging 0.77
Z1177:Plekhm2 UTSW 4 141639822 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- CAAAATGGTGGTTTCTCCGGGG -3'
(R):5'- GTTGCAGGGTCACCAAGAAG -3'

Sequencing Primer
(F):5'- GAGAGCCGGCCCGAAAG -3'
(R):5'- TCACCAAGAAGAAGAAGATTGGC -3'
Posted On2014-06-23