Incidental Mutation 'R1844:Psph'
ID207533
Institutional Source Beutler Lab
Gene Symbol Psph
Ensembl Gene ENSMUSG00000029446
Gene Namephosphoserine phosphatase
SynonymsPSPase
MMRRC Submission 039869-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1844 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location129765558-129787449 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 129766468 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Arginine at position 174 (I174R)
Ref Sequence ENSEMBL: ENSMUSP00000031399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031399] [ENSMUST00000118268] [ENSMUST00000136507] [ENSMUST00000201394]
Predicted Effect probably damaging
Transcript: ENSMUST00000031399
AA Change: I174R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031399
Gene: ENSMUSG00000029446
AA Change: I174R

DomainStartEndE-ValueType
Pfam:Hydrolase 14 191 5.7e-19 PFAM
Pfam:HAD 17 187 4e-13 PFAM
Pfam:UMPH-1 62 192 5.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118268
SMART Domains Protein: ENSMUSP00000113671
Gene: ENSMUSG00000029446

DomainStartEndE-ValueType
PDB:1L8O|B 1 94 1e-55 PDB
SCOP:d1j97a_ 15 92 2e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136280
Predicted Effect probably benign
Transcript: ENSMUST00000136507
SMART Domains Protein: ENSMUSP00000116292
Gene: ENSMUSG00000029446

DomainStartEndE-ValueType
PDB:1NNL|B 1 59 1e-32 PDB
SCOP:d1j97a_ 15 58 2e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201022
Predicted Effect probably benign
Transcript: ENSMUST00000201394
SMART Domains Protein: ENSMUSP00000144667
Gene: ENSMUSG00000029446

DomainStartEndE-ValueType
Pfam:Hydrolase 14 113 4.5e-6 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a subfamily of the phosphotransferases. This encoded enzyme is responsible for the third and last step in L-serine formation. It catalyzes magnesium-dependent hydrolysis of L-phosphoserine and is also involved in an exchange reaction between L-serine and L-phosphoserine. Deficiency of this protein is thought to be linked to Williams syndrome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik A T 7: 139,976,092 I212N probably benign Het
Aco1 A G 4: 40,197,566 K857E probably benign Het
Adam20 A G 8: 40,796,043 N397D probably benign Het
Adgrf3 T G 5: 30,199,213 D347A probably damaging Het
Ang6 C T 14: 44,001,873 E133K possibly damaging Het
Arhgap23 T A 11: 97,463,408 W205R probably damaging Het
Arhgef40 C A 14: 51,997,623 R1086S probably damaging Het
Atr G T 9: 95,905,817 A1488S probably benign Het
Cabin1 A T 10: 75,743,350 probably null Het
Cdh22 A C 2: 165,143,694 F324C probably damaging Het
Cep350 T C 1: 155,848,628 I3075V probably damaging Het
Chd9 A T 8: 90,956,695 K588* probably null Het
Clns1a A T 7: 97,696,859 I44F probably damaging Het
Colgalt1 T C 8: 71,611,351 I51T possibly damaging Het
Cpt2 C T 4: 107,904,255 E217K possibly damaging Het
Ctss A G 3: 95,546,794 probably null Het
Cyp1a1 A G 9: 57,702,697 T465A probably benign Het
Dbn1 A G 13: 55,481,347 probably null Het
Dennd1b A G 1: 139,090,405 probably null Het
Dnajc1 A C 2: 18,294,027 Y49* probably null Het
Dock10 T A 1: 80,543,201 I1188L probably damaging Het
Dsg1c T G 18: 20,283,039 probably null Het
Efcab6 G A 15: 83,967,621 T352I possibly damaging Het
Eps8l3 T C 3: 107,879,586 L26P possibly damaging Het
Fbxw26 A G 9: 109,724,878 V231A probably benign Het
Fetub G A 16: 22,935,669 E209K possibly damaging Het
Galc A T 12: 98,246,297 probably null Het
Gm6871 A T 7: 41,573,468 N65K probably benign Het
Gm8857 T C 5: 10,949,027 probably benign Het
Gstp3 A G 19: 4,057,540 I208T probably benign Het
Gtpbp3 A G 8: 71,492,628 Y448C probably benign Het
Hdac7 G T 15: 97,807,976 Q385K probably damaging Het
Hemgn C T 4: 46,396,655 V194M possibly damaging Het
Idh2 G C 7: 80,098,877 T113R probably benign Het
Jarid2 A C 13: 44,902,743 K336T possibly damaging Het
Kcnj4 C T 15: 79,485,015 V255M probably damaging Het
Ldhb C A 6: 142,494,208 W202L probably damaging Het
Lmbrd2 T A 15: 9,177,751 Y512* probably null Het
Lrp1 A G 10: 127,595,283 probably null Het
Map3k12 G A 15: 102,503,535 P365S probably damaging Het
Map3k5 G A 10: 20,104,163 D806N probably benign Het
Matn3 A G 12: 8,967,662 E438G possibly damaging Het
Mcmbp G A 7: 128,723,974 L97F probably damaging Het
Mmp3 A T 9: 7,453,662 I428L probably benign Het
Mphosph8 T C 14: 56,697,159 V855A probably damaging Het
Mycbp2 T A 14: 103,155,714 H3027L possibly damaging Het
Nbea C T 3: 56,082,436 R333H probably damaging Het
Notch1 G T 2: 26,460,434 H2231Q probably benign Het
Npas2 A T 1: 39,325,375 H266L probably damaging Het
Oas3 A G 5: 120,759,980 S833P probably damaging Het
Olfr1141 A C 2: 87,753,990 M1R probably null Het
Olfr344 T C 2: 36,568,777 Y60H probably damaging Het
Olfr808 G A 10: 129,767,856 R120H probably benign Het
Olfr994 T C 2: 85,429,921 T303A probably benign Het
Pak4 C T 7: 28,565,265 V71I possibly damaging Het
Pitpnm1 T C 19: 4,112,395 V1075A probably damaging Het
Pkp3 G A 7: 141,088,502 V555M probably damaging Het
Plekhm2 T C 4: 141,632,374 T381A probably benign Het
Plppr3 A G 10: 79,866,410 probably null Het
Ppp2r5e A T 12: 75,469,766 F216I possibly damaging Het
Ppp3ca T A 3: 136,921,911 V412D probably benign Het
Prss50 A G 9: 110,858,013 probably benign Het
Ptov1 A G 7: 44,865,567 Y207H possibly damaging Het
Ptprs A G 17: 56,434,510 S585P probably damaging Het
Rnf146 A T 10: 29,347,724 H55Q probably damaging Het
Rnf213 T A 11: 119,441,183 M2407K probably damaging Het
Rnls A C 19: 33,202,531 L55R possibly damaging Het
Rptor T C 11: 119,756,320 C246R probably damaging Het
Rrp12 C T 19: 41,877,783 probably null Het
Samd3 A G 10: 26,251,774 D223G probably damaging Het
Sdad1 G A 5: 92,305,296 Q68* probably null Het
Selenov G A 7: 28,290,422 T219M probably damaging Het
Shd A G 17: 55,971,554 D39G possibly damaging Het
Slc26a10 A T 10: 127,178,410 V245E probably damaging Het
Slit1 A G 19: 41,625,573 L820P probably damaging Het
Snap23 T C 2: 120,590,682 F96L probably benign Het
Spert C T 14: 75,583,410 V292I probably benign Het
Stkld1 A G 2: 26,950,103 H395R probably damaging Het
Syt13 G A 2: 92,940,820 G84D probably damaging Het
Terb2 T A 2: 122,186,509 L37Q probably damaging Het
Themis A G 10: 28,781,757 Y107C probably damaging Het
Top2a T A 11: 99,016,069 T249S probably benign Het
Tspo2 A T 17: 48,449,120 F71Y probably damaging Het
Ttc21b T A 2: 66,223,577 K753* probably null Het
Ttk A G 9: 83,854,862 Y458C possibly damaging Het
Ttn T C 2: 76,755,673 R21905G probably damaging Het
Ugt3a2 T A 15: 9,351,168 F88I probably benign Het
Vmn1r119 A G 7: 21,012,196 L87P probably damaging Het
Vmn1r36 A G 6: 66,716,763 F6L probably benign Het
Vmn2r15 T A 5: 109,286,994 K615* probably null Het
Wdr18 G A 10: 79,966,727 probably null Het
Wdr6 A T 9: 108,575,977 W236R probably damaging Het
Zbtb48 T C 4: 152,026,498 T187A probably benign Het
Other mutations in Psph
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0121:Psph UTSW 5 129791570 unclassified probably benign
R0539:Psph UTSW 5 129766577 unclassified probably benign
R0650:Psph UTSW 5 129791570 unclassified probably benign
R1236:Psph UTSW 5 129771476 missense probably damaging 1.00
R1474:Psph UTSW 5 129771550 missense probably damaging 1.00
R2130:Psph UTSW 5 129787539 unclassified probably null
R3857:Psph UTSW 5 129771476 missense probably damaging 1.00
R4300:Psph UTSW 5 129787465 unclassified probably null
R4368:Psph UTSW 5 129771590 missense probably benign 0.00
R4738:Psph UTSW 5 129769386 critical splice acceptor site probably null
R5306:Psph UTSW 5 129769367 missense probably damaging 1.00
R5859:Psph UTSW 5 129790621 unclassified probably benign
R6269:Psph UTSW 5 129766465 missense probably damaging 0.99
R7552:Psph UTSW 5 129770736 missense probably benign 0.01
R7593:Psph UTSW 5 129787273 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GGCGGTCAGTGTCTTAAAATG -3'
(R):5'- GCAGTGGTATAAACACGCTAGC -3'

Sequencing Primer
(F):5'- CCCTGCCATGATGATAATGGACTG -3'
(R):5'- CGCTAGCTAAGTAAAAATGCCTCTG -3'
Posted On2014-06-23