Incidental Mutation 'R1844:Jarid2'
ID207578
Institutional Source Beutler Lab
Gene Symbol Jarid2
Ensembl Gene ENSMUSG00000038518
Gene Namejumonji, AT rich interactive domain 2
Synonymsjumonji, Jmj
MMRRC Submission 039869-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1844 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location44729474-44921643 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 44902743 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 336 (K336T)
Ref Sequence ENSEMBL: ENSMUSP00000134658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044608] [ENSMUST00000173246] [ENSMUST00000173367] [ENSMUST00000173704] [ENSMUST00000173906]
Predicted Effect probably benign
Transcript: ENSMUST00000044608
AA Change: K475T

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000037774
Gene: ENSMUSG00000038518
AA Change: K475T

DomainStartEndE-ValueType
low complexity region 86 99 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
low complexity region 265 285 N/A INTRINSIC
low complexity region 334 353 N/A INTRINSIC
JmjN 554 595 1.77e-20 SMART
ARID 616 707 4.96e-24 SMART
BRIGHT 620 712 1.7e-29 SMART
low complexity region 791 800 N/A INTRINSIC
JmjC 882 1046 1.04e-50 SMART
Pfam:zf-C5HC2 1137 1191 2.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173246
AA Change: K475T

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000134205
Gene: ENSMUSG00000038518
AA Change: K475T

DomainStartEndE-ValueType
low complexity region 86 99 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
low complexity region 265 285 N/A INTRINSIC
low complexity region 334 353 N/A INTRINSIC
JmjN 554 595 1.77e-20 SMART
ARID 616 707 4.96e-24 SMART
BRIGHT 620 712 1.7e-29 SMART
low complexity region 791 800 N/A INTRINSIC
JmjC 882 1046 1.04e-50 SMART
Pfam:zf-C5HC2 1137 1191 2.4e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000173367
AA Change: K336T

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000134658
Gene: ENSMUSG00000038518
AA Change: K336T

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
low complexity region 126 146 N/A INTRINSIC
low complexity region 195 214 N/A INTRINSIC
JmjN 415 456 1.77e-20 SMART
PDB:2RQ5|A 476 507 3e-14 PDB
Blast:ARID 477 507 2e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173704
AA Change: K475T

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000134675
Gene: ENSMUSG00000038518
AA Change: K475T

DomainStartEndE-ValueType
low complexity region 86 99 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
low complexity region 265 285 N/A INTRINSIC
low complexity region 334 353 N/A INTRINSIC
JmjN 554 595 1.77e-20 SMART
ARID 616 707 4.96e-24 SMART
BRIGHT 620 712 1.7e-29 SMART
low complexity region 791 800 N/A INTRINSIC
JmjC 882 1046 1.04e-50 SMART
Pfam:zf-C5HC2 1137 1190 1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173906
AA Change: K437T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000134630
Gene: ENSMUSG00000038518
AA Change: K437T

DomainStartEndE-ValueType
low complexity region 48 61 N/A INTRINSIC
low complexity region 143 157 N/A INTRINSIC
low complexity region 227 247 N/A INTRINSIC
low complexity region 296 315 N/A INTRINSIC
JmjN 516 557 1.77e-20 SMART
ARID 578 669 4.96e-24 SMART
BRIGHT 582 674 1.7e-29 SMART
low complexity region 753 762 N/A INTRINSIC
JmjC 844 1008 1.04e-50 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174683
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Jumonji- and AT-rich interaction domain (ARID)-domain-containing protein. The encoded protein is a DNA-binding protein that functions as a transcriptional repressor. This protein interacts with the Polycomb repressive complex 2 (PRC2) which plays an essential role in regulating gene expression during embryonic development. This protein facilitates the recruitment of the PRC2 complex to target genes. Alternate splicing results in multiple transcript variants. Mutations in this gene are associated with chronic myeloid malignancies. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygous mutants show strain-specific phenotypes, including embryonic death and defective neural tube closure, impaired hematopoiesis and hypoplasia of liver, thymus and spleen. Homozygotes for another mutation die at birth with cardiac defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik A T 7: 139,976,092 I212N probably benign Het
Aco1 A G 4: 40,197,566 K857E probably benign Het
Adam20 A G 8: 40,796,043 N397D probably benign Het
Adgrf3 T G 5: 30,199,213 D347A probably damaging Het
Ang6 C T 14: 44,001,873 E133K possibly damaging Het
Arhgap23 T A 11: 97,463,408 W205R probably damaging Het
Arhgef40 C A 14: 51,997,623 R1086S probably damaging Het
Atr G T 9: 95,905,817 A1488S probably benign Het
Cabin1 A T 10: 75,743,350 probably null Het
Cdh22 A C 2: 165,143,694 F324C probably damaging Het
Cep350 T C 1: 155,848,628 I3075V probably damaging Het
Chd9 A T 8: 90,956,695 K588* probably null Het
Clns1a A T 7: 97,696,859 I44F probably damaging Het
Colgalt1 T C 8: 71,611,351 I51T possibly damaging Het
Cpt2 C T 4: 107,904,255 E217K possibly damaging Het
Ctss A G 3: 95,546,794 probably null Het
Cyp1a1 A G 9: 57,702,697 T465A probably benign Het
Dbn1 A G 13: 55,481,347 probably null Het
Dennd1b A G 1: 139,090,405 probably null Het
Dnajc1 A C 2: 18,294,027 Y49* probably null Het
Dock10 T A 1: 80,543,201 I1188L probably damaging Het
Dsg1c T G 18: 20,283,039 probably null Het
Efcab6 G A 15: 83,967,621 T352I possibly damaging Het
Eps8l3 T C 3: 107,879,586 L26P possibly damaging Het
Fbxw26 A G 9: 109,724,878 V231A probably benign Het
Fetub G A 16: 22,935,669 E209K possibly damaging Het
Galc A T 12: 98,246,297 probably null Het
Gm6871 A T 7: 41,573,468 N65K probably benign Het
Gm8857 T C 5: 10,949,027 probably benign Het
Gstp3 A G 19: 4,057,540 I208T probably benign Het
Gtpbp3 A G 8: 71,492,628 Y448C probably benign Het
Hdac7 G T 15: 97,807,976 Q385K probably damaging Het
Hemgn C T 4: 46,396,655 V194M possibly damaging Het
Idh2 G C 7: 80,098,877 T113R probably benign Het
Kcnj4 C T 15: 79,485,015 V255M probably damaging Het
Ldhb C A 6: 142,494,208 W202L probably damaging Het
Lmbrd2 T A 15: 9,177,751 Y512* probably null Het
Lrp1 A G 10: 127,595,283 probably null Het
Map3k12 G A 15: 102,503,535 P365S probably damaging Het
Map3k5 G A 10: 20,104,163 D806N probably benign Het
Matn3 A G 12: 8,967,662 E438G possibly damaging Het
Mcmbp G A 7: 128,723,974 L97F probably damaging Het
Mmp3 A T 9: 7,453,662 I428L probably benign Het
Mphosph8 T C 14: 56,697,159 V855A probably damaging Het
Mycbp2 T A 14: 103,155,714 H3027L possibly damaging Het
Nbea C T 3: 56,082,436 R333H probably damaging Het
Notch1 G T 2: 26,460,434 H2231Q probably benign Het
Npas2 A T 1: 39,325,375 H266L probably damaging Het
Oas3 A G 5: 120,759,980 S833P probably damaging Het
Olfr1141 A C 2: 87,753,990 M1R probably null Het
Olfr344 T C 2: 36,568,777 Y60H probably damaging Het
Olfr808 G A 10: 129,767,856 R120H probably benign Het
Olfr994 T C 2: 85,429,921 T303A probably benign Het
Pak4 C T 7: 28,565,265 V71I possibly damaging Het
Pitpnm1 T C 19: 4,112,395 V1075A probably damaging Het
Pkp3 G A 7: 141,088,502 V555M probably damaging Het
Plekhm2 T C 4: 141,632,374 T381A probably benign Het
Plppr3 A G 10: 79,866,410 probably null Het
Ppp2r5e A T 12: 75,469,766 F216I possibly damaging Het
Ppp3ca T A 3: 136,921,911 V412D probably benign Het
Prss50 A G 9: 110,858,013 probably benign Het
Psph A C 5: 129,766,468 I174R probably damaging Het
Ptov1 A G 7: 44,865,567 Y207H possibly damaging Het
Ptprs A G 17: 56,434,510 S585P probably damaging Het
Rnf146 A T 10: 29,347,724 H55Q probably damaging Het
Rnf213 T A 11: 119,441,183 M2407K probably damaging Het
Rnls A C 19: 33,202,531 L55R possibly damaging Het
Rptor T C 11: 119,756,320 C246R probably damaging Het
Rrp12 C T 19: 41,877,783 probably null Het
Samd3 A G 10: 26,251,774 D223G probably damaging Het
Sdad1 G A 5: 92,305,296 Q68* probably null Het
Selenov G A 7: 28,290,422 T219M probably damaging Het
Shd A G 17: 55,971,554 D39G possibly damaging Het
Slc26a10 A T 10: 127,178,410 V245E probably damaging Het
Slit1 A G 19: 41,625,573 L820P probably damaging Het
Snap23 T C 2: 120,590,682 F96L probably benign Het
Spert C T 14: 75,583,410 V292I probably benign Het
Stkld1 A G 2: 26,950,103 H395R probably damaging Het
Syt13 G A 2: 92,940,820 G84D probably damaging Het
Terb2 T A 2: 122,186,509 L37Q probably damaging Het
Themis A G 10: 28,781,757 Y107C probably damaging Het
Top2a T A 11: 99,016,069 T249S probably benign Het
Tspo2 A T 17: 48,449,120 F71Y probably damaging Het
Ttc21b T A 2: 66,223,577 K753* probably null Het
Ttk A G 9: 83,854,862 Y458C possibly damaging Het
Ttn T C 2: 76,755,673 R21905G probably damaging Het
Ugt3a2 T A 15: 9,351,168 F88I probably benign Het
Vmn1r119 A G 7: 21,012,196 L87P probably damaging Het
Vmn1r36 A G 6: 66,716,763 F6L probably benign Het
Vmn2r15 T A 5: 109,286,994 K615* probably null Het
Wdr18 G A 10: 79,966,727 probably null Het
Wdr6 A T 9: 108,575,977 W236R probably damaging Het
Zbtb48 T C 4: 152,026,498 T187A probably benign Het
Other mutations in Jarid2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01572:Jarid2 APN 13 44884835 missense probably damaging 1.00
IGL02217:Jarid2 APN 13 44913201 missense probably damaging 1.00
IGL02378:Jarid2 APN 13 44914325 missense probably damaging 0.98
IGL02604:Jarid2 APN 13 44874401 missense probably damaging 1.00
IGL02865:Jarid2 APN 13 44910560 missense probably damaging 1.00
IGL02926:Jarid2 APN 13 44902929 missense probably benign 0.03
R0057:Jarid2 UTSW 13 44884856 missense probably damaging 0.96
R0426:Jarid2 UTSW 13 44840882 critical splice donor site probably null
R0545:Jarid2 UTSW 13 44902831 missense probably benign 0.10
R0562:Jarid2 UTSW 13 44902359 missense probably damaging 0.99
R1192:Jarid2 UTSW 13 44906545 missense probably damaging 1.00
R1241:Jarid2 UTSW 13 44884892 splice site probably benign
R1254:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1464:Jarid2 UTSW 13 44848381 missense probably damaging 0.97
R1464:Jarid2 UTSW 13 44848381 missense probably damaging 0.97
R1552:Jarid2 UTSW 13 44911199 missense probably damaging 1.00
R1728:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1729:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1730:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1739:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1783:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1785:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1896:Jarid2 UTSW 13 44884882 critical splice donor site probably null
R1965:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1966:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1995:Jarid2 UTSW 13 44874441 missense probably damaging 1.00
R2120:Jarid2 UTSW 13 44906336 missense probably benign 0.17
R2142:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R2172:Jarid2 UTSW 13 44902539 missense probably damaging 0.99
R2242:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R2245:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R3110:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R3111:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R3112:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R3115:Jarid2 UTSW 13 44896466 missense probably damaging 1.00
R3620:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R3704:Jarid2 UTSW 13 44902355 missense probably benign
R3802:Jarid2 UTSW 13 44902831 missense probably benign 0.10
R3804:Jarid2 UTSW 13 44902831 missense probably benign 0.10
R4126:Jarid2 UTSW 13 44902256 missense probably damaging 1.00
R4127:Jarid2 UTSW 13 44902256 missense probably damaging 1.00
R4128:Jarid2 UTSW 13 44902256 missense probably damaging 1.00
R4153:Jarid2 UTSW 13 44910426 missense probably damaging 1.00
R4844:Jarid2 UTSW 13 44913772 missense probably damaging 0.96
R5044:Jarid2 UTSW 13 44906565 missense probably damaging 1.00
R5329:Jarid2 UTSW 13 44906271 missense possibly damaging 0.49
R5632:Jarid2 UTSW 13 44896290 missense probably damaging 0.97
R5820:Jarid2 UTSW 13 44902301 missense possibly damaging 0.96
R6267:Jarid2 UTSW 13 44903063 missense possibly damaging 0.93
R6296:Jarid2 UTSW 13 44903063 missense possibly damaging 0.93
R6479:Jarid2 UTSW 13 44848289 missense probably benign 0.22
R6619:Jarid2 UTSW 13 44874396 missense probably damaging 1.00
R6633:Jarid2 UTSW 13 44884877 missense probably damaging 0.97
R6970:Jarid2 UTSW 13 44902985 missense probably damaging 1.00
R7020:Jarid2 UTSW 13 44884824 missense probably damaging 1.00
R7155:Jarid2 UTSW 13 44902462 missense probably damaging 1.00
R7223:Jarid2 UTSW 13 44896322 missense possibly damaging 0.89
R7265:Jarid2 UTSW 13 44902272 missense probably benign 0.29
R8321:Jarid2 UTSW 13 44848386 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCATGCACTAAGGAGGTGGG -3'
(R):5'- CTGACTCGATGTAGATGAGCGG -3'

Sequencing Primer
(F):5'- GCTGCGGAATTCCAAAAG -3'
(R):5'- TGAGGACAGGGATCTCGTC -3'
Posted On2014-06-23