Incidental Mutation 'R1845:Ppip5k2'
ID 207606
Institutional Source Beutler Lab
Gene Symbol Ppip5k2
Ensembl Gene ENSMUSG00000040648
Gene Name diphosphoinositol pentakisphosphate kinase 2
Synonyms Hisppd1, Vip2
MMRRC Submission 039870-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.191) question?
Stock # R1845 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 97706048-97770411 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 97723806 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 928 (D928G)
Ref Sequence ENSEMBL: ENSMUSP00000108466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042509] [ENSMUST00000112845] [ENSMUST00000171129]
AlphaFold Q6ZQB6
Predicted Effect probably benign
Transcript: ENSMUST00000042509
AA Change: D934G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000043401
Gene: ENSMUSG00000040648
AA Change: D934G

DomainStartEndE-ValueType
low complexity region 29 41 N/A INTRINSIC
PDB:4NZO|A 42 366 N/A PDB
Pfam:His_Phos_2 379 894 2.9e-112 PFAM
low complexity region 1073 1092 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112845
AA Change: D928G

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000108466
Gene: ENSMUSG00000040648
AA Change: D928G

DomainStartEndE-ValueType
low complexity region 29 41 N/A INTRINSIC
PDB:4NZO|A 42 366 N/A PDB
Pfam:His_Phos_2 379 894 6.9e-141 PFAM
low complexity region 993 1006 N/A INTRINSIC
low complexity region 1192 1211 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171129
AA Change: D928G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132889
Gene: ENSMUSG00000040648
AA Change: D928G

DomainStartEndE-ValueType
low complexity region 29 41 N/A INTRINSIC
PDB:4NZO|A 42 366 N/A PDB
Pfam:His_Phos_2 379 894 2.9e-112 PFAM
low complexity region 1073 1092 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189992
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the histidine acid phosphatase family of proteins. Despite containing a histidine acid phosphatase domain, the encoded protein functions as an inositol pyrophosphate kinase, and is thought to lack phosphatase activity. This kinase activity is the mechanism by which the encoded protein synthesizes high-energy inositol pyrophosphates, which act as signaling molecules that regulate cellular homeostasis and other processes. This gene may be associated with autism spectrum disorder in human patients. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T A 12: 55,304,332 I142N possibly damaging Het
1110038F14Rik CGGG CGGGGGG 15: 76,949,663 probably benign Het
Abca17 A T 17: 24,267,716 C1446S probably damaging Het
Asb16 C A 11: 102,276,756 A316E possibly damaging Het
Axdnd1 C T 1: 156,376,544 V384I possibly damaging Het
BC024139 A T 15: 76,125,261 L207* probably null Het
Bcl3 T G 7: 19,809,627 S305R probably damaging Het
Cachd1 T C 4: 100,777,358 V77A probably benign Het
Cd101 C T 3: 101,029,448 probably null Het
Cela1 T C 15: 100,685,167 N64S probably benign Het
Cep128 T C 12: 91,289,598 D366G probably benign Het
Col12a1 A G 9: 79,697,541 V675A probably benign Het
Copg1 A G 6: 87,893,818 Y201C probably damaging Het
Cyp24a1 T C 2: 170,487,917 R372G probably benign Het
Dcaf1 A C 9: 106,851,962 I567L probably benign Het
Dcn A G 10: 97,506,674 D164G probably benign Het
Dnase2a T A 8: 84,909,322 H113Q probably benign Het
Espl1 T C 15: 102,299,013 V304A probably benign Het
Fam193a A G 5: 34,443,372 D315G possibly damaging Het
Fkbp8 T A 8: 70,531,035 probably null Het
Foxp4 T A 17: 47,877,959 T321S probably null Het
Fut10 A G 8: 31,236,300 N361S probably damaging Het
Gm13762 A G 2: 88,973,138 V251A probably benign Het
Gyg A T 3: 20,151,122 V94D probably damaging Het
Has2 T C 15: 56,668,578 K247R probably damaging Het
Helz2 G T 2: 181,232,085 D2205E probably benign Het
Hps6 T A 19: 46,004,970 S449T probably benign Het
Ints10 T C 8: 68,794,671 Y64H probably damaging Het
Kalrn T C 16: 34,356,961 H278R probably damaging Het
Klhdc8a T C 1: 132,303,810 V280A possibly damaging Het
Klk1b5 A G 7: 44,220,125 M210V probably benign Het
Kmt2c G A 5: 25,373,436 A614V probably benign Het
Lck T A 4: 129,558,086 I45F probably benign Het
Lin7a A C 10: 107,412,059 E75A probably damaging Het
Lrp1 A T 10: 127,578,673 C1070S probably damaging Het
Mapk8ip3 G T 17: 24,914,583 N289K probably benign Het
Mbtps1 T C 8: 119,522,493 D686G probably benign Het
Mknk1 T A 4: 115,873,231 C178* probably null Het
Mtmr6 A G 14: 60,296,735 N474S probably damaging Het
Mvb12b A G 2: 33,840,157 probably null Het
Myh6 T C 14: 54,944,674 K1759R probably damaging Het
Nfatc1 T C 18: 80,635,531 K881E possibly damaging Het
Nlrp10 A G 7: 108,927,041 F30S probably damaging Het
Nop14 G T 5: 34,650,328 A430E possibly damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr1212 A G 2: 88,958,867 I134V probably damaging Het
Olfr347 A T 2: 36,734,842 I174F probably damaging Het
Olfr775 A G 10: 129,250,594 E20G probably benign Het
Olfr794 A T 10: 129,571,348 Q231L probably damaging Het
Olfr829 A T 9: 18,857,486 Y287F possibly damaging Het
Osbpl7 C A 11: 97,059,128 S378R probably damaging Het
Otof A T 5: 30,371,723 Y1775* probably null Het
Parp16 T C 9: 65,215,594 S46P possibly damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pi16 A T 17: 29,319,387 Q58L possibly damaging Het
Pld3 C A 7: 27,539,452 M190I probably benign Het
Plscr4 T G 9: 92,490,046 I290S probably damaging Het
Ppp1r13l T A 7: 19,368,611 L15Q probably damaging Het
Ptpn14 C A 1: 189,839,502 S263R possibly damaging Het
Sema7a G A 9: 57,954,899 V178I possibly damaging Het
Sesn2 A T 4: 132,497,070 Y342* probably null Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sltm A G 9: 70,543,032 N38S possibly damaging Het
Smg1 T C 7: 118,154,622 probably benign Het
Spsb1 A T 4: 149,906,910 V67E probably damaging Het
Suox A G 10: 128,670,539 V540A possibly damaging Het
Tbc1d12 T A 19: 38,911,085 I483N probably damaging Het
Tbcb A T 7: 30,224,499 D198E possibly damaging Het
Tbce T C 13: 14,019,709 K122E probably benign Het
Tcap T A 11: 98,384,379 L113H probably damaging Het
Thsd7a A T 6: 12,321,041 I1545N probably damaging Het
Tmed10 T C 12: 85,374,503 T55A possibly damaging Het
Tmem268 T A 4: 63,579,943 V200D probably damaging Het
Tmem45b A C 9: 31,431,355 I50M probably damaging Het
Trp53bp2 T C 1: 182,458,903 W1103R probably damaging Het
Ttn C T 2: 76,764,033 V20524M probably damaging Het
Ulk2 A T 11: 61,812,738 N379K probably benign Het
Vmn1r59 A G 7: 5,454,554 V69A probably benign Het
Vmn2r10 A T 5: 109,001,995 Y394* probably null Het
Zfp212 T C 6: 47,931,541 S485P probably benign Het
Zfp512b A T 2: 181,585,735 C776S probably damaging Het
Zfp518b A G 5: 38,671,741 Y974H probably damaging Het
Other mutations in Ppip5k2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01927:Ppip5k2 APN 1 97713123 missense probably damaging 1.00
IGL02266:Ppip5k2 APN 1 97733972 missense possibly damaging 0.68
IGL02705:Ppip5k2 APN 1 97759199 missense probably damaging 1.00
IGL03229:Ppip5k2 APN 1 97728961 missense probably damaging 1.00
P0033:Ppip5k2 UTSW 1 97717528 missense probably damaging 0.98
R0082:Ppip5k2 UTSW 1 97759332 nonsense probably null
R0242:Ppip5k2 UTSW 1 97741091 missense probably damaging 1.00
R0242:Ppip5k2 UTSW 1 97741091 missense probably damaging 1.00
R0267:Ppip5k2 UTSW 1 97728997 missense probably damaging 1.00
R0281:Ppip5k2 UTSW 1 97716553 missense possibly damaging 0.95
R0373:Ppip5k2 UTSW 1 97740537 nonsense probably null
R0402:Ppip5k2 UTSW 1 97719854 missense probably benign 0.00
R0423:Ppip5k2 UTSW 1 97761427 missense possibly damaging 0.95
R0613:Ppip5k2 UTSW 1 97752740 nonsense probably null
R0751:Ppip5k2 UTSW 1 97749652 nonsense probably null
R1121:Ppip5k2 UTSW 1 97756860 missense probably damaging 1.00
R1265:Ppip5k2 UTSW 1 97719900 missense probably benign 0.00
R1436:Ppip5k2 UTSW 1 97711782 missense probably benign 0.04
R1543:Ppip5k2 UTSW 1 97740882 missense probably damaging 1.00
R1739:Ppip5k2 UTSW 1 97728957 missense probably damaging 1.00
R2191:Ppip5k2 UTSW 1 97744110 missense probably damaging 0.99
R2430:Ppip5k2 UTSW 1 97735030 missense probably damaging 1.00
R2762:Ppip5k2 UTSW 1 97717509 missense probably damaging 1.00
R3014:Ppip5k2 UTSW 1 97744075 missense probably damaging 0.99
R3759:Ppip5k2 UTSW 1 97755885 critical splice donor site probably null
R4603:Ppip5k2 UTSW 1 97755136 missense probably damaging 1.00
R4772:Ppip5k2 UTSW 1 97721067 unclassified probably benign
R4951:Ppip5k2 UTSW 1 97711749 missense possibly damaging 0.77
R5348:Ppip5k2 UTSW 1 97747592 missense possibly damaging 0.94
R5350:Ppip5k2 UTSW 1 97721128 missense probably damaging 0.98
R5584:Ppip5k2 UTSW 1 97750641 missense probably damaging 1.00
R5599:Ppip5k2 UTSW 1 97740598 missense probably damaging 1.00
R5883:Ppip5k2 UTSW 1 97707810 missense possibly damaging 0.53
R5898:Ppip5k2 UTSW 1 97744162 intron probably benign
R6184:Ppip5k2 UTSW 1 97734005 missense possibly damaging 0.89
R6221:Ppip5k2 UTSW 1 97730028 missense probably damaging 1.00
R6775:Ppip5k2 UTSW 1 97719860 missense possibly damaging 0.49
R7250:Ppip5k2 UTSW 1 97745462 missense probably benign 0.00
R7329:Ppip5k2 UTSW 1 97750753 splice site probably null
R7357:Ppip5k2 UTSW 1 97759216 missense possibly damaging 0.91
R7852:Ppip5k2 UTSW 1 97741171 missense probably damaging 0.99
R7884:Ppip5k2 UTSW 1 97740482 missense probably benign 0.00
R8006:Ppip5k2 UTSW 1 97734106 missense probably benign 0.00
R8134:Ppip5k2 UTSW 1 97745163 missense probably benign 0.12
R8274:Ppip5k2 UTSW 1 97759216 missense possibly damaging 0.91
R8436:Ppip5k2 UTSW 1 97755888 missense probably benign
R8440:Ppip5k2 UTSW 1 97747551 missense probably damaging 0.99
R8895:Ppip5k2 UTSW 1 97711819 missense probably benign
R9017:Ppip5k2 UTSW 1 97727414 missense probably damaging 1.00
R9061:Ppip5k2 UTSW 1 97717462 missense probably damaging 1.00
R9441:Ppip5k2 UTSW 1 97745196 missense probably benign 0.00
R9533:Ppip5k2 UTSW 1 97734067 missense probably benign 0.11
R9715:Ppip5k2 UTSW 1 97749587 missense
R9792:Ppip5k2 UTSW 1 97744097 nonsense probably null
R9793:Ppip5k2 UTSW 1 97744097 nonsense probably null
R9795:Ppip5k2 UTSW 1 97744097 nonsense probably null
Z1177:Ppip5k2 UTSW 1 97716605 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGTTAGCTTGCCCTGTACAG -3'
(R):5'- AGCTGGCTGTTAGTTATCAGAAG -3'

Sequencing Primer
(F):5'- TGTACAGGACACACTCTCCATAG -3'
(R):5'- CAGAAGCATTTTATTGACGTTTAGAG -3'
Posted On 2014-06-23