Mutagenetix > Incidental Mutations

Incidental Mutation 'R0115:Sorcs1'

20761

Institutional Source

Beutler Lab

Gene Symbol

Sorcs1

Ensembl Gene

ENSMUSG00000043531

Gene Name

sortilin-related VPS10 domain containing receptor 1

Synonyms

MMRRC Submission

038401-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.111) question?

Stock #

R0115 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

50143299-50678646 bp(-) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

A to G at 50636453 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000147591 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072685] [ENSMUST00000111756] [ENSMUST00000164039] [ENSMUST00000209413] [ENSMUST00000209783] [ENSMUST00000211008] [ENSMUST00000211687]

Predicted Effect

probably benign
Transcript: ENSMUST00000072685

SMART Domains

Protein: ENSMUSP00000072472
Gene: ENSMUSG00000043531

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	94	113	N/A	INTRINSIC
VPS10	196	797	N/A	SMART
PKD	799	889	3.84e-1	SMART
PKD	897	975	8.63e-1	SMART
transmembrane domain	1098	1120	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000111756

SMART Domains

Protein: ENSMUSP00000107386
Gene: ENSMUSG00000043531

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	94	113	N/A	INTRINSIC
VPS10	196	797	N/A	SMART
PKD	799	889	3.84e-1	SMART
PKD	897	975	8.63e-1	SMART
transmembrane domain	1098	1120	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000164039

SMART Domains

Protein: ENSMUSP00000132615
Gene: ENSMUSG00000043531

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	94	113	N/A	INTRINSIC
VPS10	196	797	N/A	SMART
PKD	799	889	3.84e-1	SMART
PKD	897	975	8.63e-1	SMART
transmembrane domain	1098	1120	N/A	INTRINSIC
low complexity region	1129	1142	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000209413

Predicted Effect

probably benign
Transcript: ENSMUST00000209783

Predicted Effect

probably benign
Transcript: ENSMUST00000211008

Predicted Effect

probably benign
Transcript: ENSMUST00000211687

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 94.2%
20x: 86.0%

Validation Efficiency

98% (98/100)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. Two of the five family members (sortilin and sortilin-related receptor) are synthesized as preproproteins; it is not yet known if this encoded protein is also a preproprotein. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Female mice homozygous for a null allele have abnormal amyloid beta levels in the brain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011I03Rik	G	A	18: 57,594,142		probably benign	Het
2310007B03Rik	A	T	1: 93,159,725	S135R	possibly damaging	Het
4921528I07Rik	A	G	9: 114,279,384		noncoding transcript	Het
Alas1	A	T	9: 106,238,252		probably null	Het
Arf5	A	G	6: 28,426,076	Y154C	probably damaging	Het
Arhgap20	T	A	9: 51,838,972	I344N	probably damaging	Het
Arhgap30	A	C	1: 171,407,948	E630A	possibly damaging	Het
B4galt5	A	G	2: 167,309,234	L118P	probably damaging	Het
Bdp1	A	G	13: 100,041,454	I1969T	probably benign	Het
Bysl	C	T	17: 47,610,942	R77Q	probably benign	Het
Cap1	A	T	4: 122,863,075	H272Q	possibly damaging	Het
Ccdc146	T	C	5: 21,322,756	I187M	possibly damaging	Het
Cdk13	C	A	13: 17,719,494	A1123S	probably damaging	Het
Ces5a	A	T	8: 93,502,183	M473K	probably damaging	Het
Chd8	A	G	14: 52,237,206	S123P	probably benign	Het
Cwc22	G	A	2: 77,908,111	A497V	probably damaging	Het
Cwh43	T	C	5: 73,418,027	S296P	probably damaging	Het
Cyp2c50	T	A	19: 40,092,393		probably benign	Het
Dlg1	C	A	16: 31,805,690	Y399*	probably null	Het
Drosha	A	T	15: 12,846,130	E92D	probably benign	Het
Fanca	C	T	8: 123,268,539	G1408D	probably benign	Het
Frem1	T	A	4: 82,936,169	D1621V	possibly damaging	Het
Frem2	G	A	3: 53,656,208	R293C	probably damaging	Het
Fut8	T	A	12: 77,448,560	V308D	probably damaging	Het
Glipr1	A	G	10: 111,993,541	I105T	probably benign	Het
Glmn	A	T	5: 107,560,934	S385T	probably benign	Het
Gm281	A	G	14: 13,899,571	V117A	probably damaging	Het
Gon4l	T	A	3: 88,895,682	V1200D	probably damaging	Het
Gpc1	G	A	1: 92,857,499	D387N	probably damaging	Het
Gsdmc	A	G	15: 63,803,637	Y110H	probably damaging	Het
Gucy1b1	T	A	3: 82,034,391	H586L	probably benign	Het
Gucy2e	A	G	11: 69,236,632	L5P	unknown	Het
Hectd4	A	G	5: 121,295,506		probably benign	Het
Hmcn1	T	A	1: 150,808,647	I391F	possibly damaging	Het
Hsf4	A	T	8: 105,272,704		probably null	Het
I830077J02Rik	G	A	3: 105,926,570	T90M	probably damaging	Het
Ino80	A	T	2: 119,431,016	H722Q	probably damaging	Het
Kcnma1	C	A	14: 23,314,175	R980L	probably damaging	Het
Kif1a	A	G	1: 93,046,778		probably benign	Het
Klhdc7b	A	G	15: 89,388,521	H1202R	probably benign	Het
Lig3	A	G	11: 82,793,935	D559G	probably damaging	Het
Lyst	T	C	13: 13,677,952	V2179A	probably benign	Het
Mansc4	A	G	6: 147,075,227	I297T	possibly damaging	Het
March6	A	T	15: 31,475,812	F633I	probably benign	Het
Marf1	C	T	16: 14,142,534	A549T	probably damaging	Het
Megf10	G	T	18: 57,259,802	V424L	possibly damaging	Het
Mfsd13a	C	T	19: 46,366,504	T40I	probably benign	Het
Mib2	A	G	4: 155,656,062		probably benign	Het
Mut	C	T	17: 40,956,227	T564M	probably damaging	Het
Myh8	A	G	11: 67,306,264		probably benign	Het
Mypn	T	C	10: 63,192,380		probably benign	Het
Nf1	G	A	11: 79,468,876		probably null	Het
Notch3	T	A	17: 32,133,462	T1866S	possibly damaging	Het
Olfr108	C	T	17: 37,445,779	A86V	probably benign	Het
Olfr1189	A	T	2: 88,592,655	I284F	probably damaging	Het
Olfr1301	T	A	2: 111,754,585	M112K	probably damaging	Het
Olfr390	A	G	11: 73,787,315	I126V	possibly damaging	Het
Pkhd1	A	T	1: 20,350,490	I2464N	probably damaging	Het
Pkn1	A	G	8: 83,671,029	S817P	probably damaging	Het
Prkg2	A	T	5: 98,994,655		probably null	Het
Prl8a6	T	C	13: 27,433,101	D201G	probably benign	Het
Psmd1	C	T	1: 86,083,271	T356I	possibly damaging	Het
Ptk6	G	A	2: 181,202,527		probably benign	Het
Ptprn2	T	C	12: 117,211,846		probably benign	Het
Rbm42	G	A	7: 30,647,775	T106I	probably damaging	Het
Rims4	A	T	2: 163,864,120	V198E	probably damaging	Het
Ripk1	T	C	13: 34,009,750	S32P	probably damaging	Het
Rorc	T	C	3: 94,377,609		probably benign	Het
Rpl22l1	T	C	3: 28,806,536	F15L	probably damaging	Het
Slc6a20a	C	A	9: 123,678,758	A17S	possibly damaging	Het
Sp100	A	G	1: 85,650,131		probably benign	Het
Ssc5d	G	A	7: 4,927,881		probably benign	Het
Taf11	A	G	17: 27,907,661	L4P	probably benign	Het
Tm2d3	A	G	7: 65,695,334		probably benign	Het
Tmub2	T	C	11: 102,288,375		probably null	Het
Trim34a	T	A	7: 104,247,902	C58S	probably damaging	Het
Trpc3	T	C	3: 36,624,417	I840V	probably benign	Het
Trpm6	T	C	19: 18,829,952	V1020A	probably damaging	Het
Vmn1r214	T	A	13: 23,035,294	Y319*	probably null	Het
Vmn1r59	T	C	7: 5,454,116	N215S	probably benign	Het
Vmn2r74	T	C	7: 85,957,356	M261V	probably benign	Het
Vmn2r89	T	C	14: 51,456,120	F309S	probably damaging	Het
Wdr95	A	T	5: 149,564,390	D163V	probably damaging	Het
Xirp2	T	A	2: 67,509,909	F831L	possibly damaging	Het
Ythdc2	C	T	18: 44,841,423		probably benign	Het

Other mutations in Sorcs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Sorcs1	APN	19	50190054	missense	probably damaging	1.00
IGL00983:Sorcs1	APN	19	50176128	missense	probably damaging	0.98
IGL01125:Sorcs1	APN	19	50228201	missense	probably damaging	1.00
IGL01320:Sorcs1	APN	19	50288079	splice site	probably benign
IGL01445:Sorcs1	APN	19	50153066	missense	probably damaging	1.00
IGL01682:Sorcs1	APN	19	50181506	missense	probably benign	0.43
IGL01799:Sorcs1	APN	19	50230209	critical splice donor site	probably null
IGL02044:Sorcs1	APN	19	50288159	splice site	probably benign
IGL02111:Sorcs1	APN	19	50230245	missense	probably benign	0.00
IGL02364:Sorcs1	APN	19	50333598	missense	probably damaging	1.00
IGL02378:Sorcs1	APN	19	50182671	nonsense	probably null
IGL02498:Sorcs1	APN	19	50678168	missense	probably benign
IGL02658:Sorcs1	APN	19	50190092	missense	probably damaging	1.00
IGL02939:Sorcs1	APN	19	50677930	nonsense	probably null
IGL02942:Sorcs1	APN	19	50475437	missense	probably damaging	1.00
IGL03057:Sorcs1	APN	19	50259756	nonsense	probably null
IGL03230:Sorcs1	APN	19	50242093	missense	probably damaging	1.00
P0033:Sorcs1	UTSW	19	50152907	missense	probably damaging	0.98
R0109:Sorcs1	UTSW	19	50378891	splice site	probably benign
R0242:Sorcs1	UTSW	19	50228221	missense	probably damaging	1.00
R0242:Sorcs1	UTSW	19	50228221	missense	probably damaging	1.00
R0325:Sorcs1	UTSW	19	50313042	splice site	probably null
R0481:Sorcs1	UTSW	19	50636453	intron	probably benign
R0581:Sorcs1	UTSW	19	50252701	missense	possibly damaging	0.70
R0669:Sorcs1	UTSW	19	50241942	splice site	probably benign
R0980:Sorcs1	UTSW	19	50232323	missense	probably benign	0.04
R1158:Sorcs1	UTSW	19	50144160	unclassified	probably benign
R1519:Sorcs1	UTSW	19	50252587	missense	probably benign	0.05
R1669:Sorcs1	UTSW	19	50475422	missense	probably damaging	0.99
R1779:Sorcs1	UTSW	19	50175043	splice site	probably benign
R1783:Sorcs1	UTSW	19	50228309	critical splice acceptor site	probably null
R1927:Sorcs1	UTSW	19	50222195	missense	probably damaging	1.00
R1935:Sorcs1	UTSW	19	50232644	missense	probably damaging	0.96
R1936:Sorcs1	UTSW	19	50232644	missense	probably damaging	0.96
R2109:Sorcs1	UTSW	19	50678192	missense	probably benign
R2206:Sorcs1	UTSW	19	50230217	missense	possibly damaging	0.81
R2207:Sorcs1	UTSW	19	50230217	missense	possibly damaging	0.81
R3031:Sorcs1	UTSW	19	50225175	missense	probably damaging	0.98
R3032:Sorcs1	UTSW	19	50225175	missense	probably damaging	0.98
R3107:Sorcs1	UTSW	19	50210650	missense	possibly damaging	0.83
R3508:Sorcs1	UTSW	19	50225175	missense	probably damaging	0.98
R3738:Sorcs1	UTSW	19	50151221	missense	probably benign	0.03
R4127:Sorcs1	UTSW	19	50222159	missense	probably benign	0.29
R4212:Sorcs1	UTSW	19	50225175	missense	probably damaging	0.98
R4213:Sorcs1	UTSW	19	50225175	missense	probably damaging	0.98
R4385:Sorcs1	UTSW	19	50190161	missense	probably benign	0.01
R4424:Sorcs1	UTSW	19	50378941	missense	probably damaging	0.97
R4603:Sorcs1	UTSW	19	50312964	critical splice donor site	probably null
R4679:Sorcs1	UTSW	19	50182669	missense	probably benign
R4780:Sorcs1	UTSW	19	50143981	unclassified	probably benign
R4781:Sorcs1	UTSW	19	50182681	missense	probably damaging	1.00
R4823:Sorcs1	UTSW	19	50678140	missense	possibly damaging	0.92
R4823:Sorcs1	UTSW	19	50230302	missense	possibly damaging	0.87
R4883:Sorcs1	UTSW	19	50232303	missense	probably benign	0.00
R5091:Sorcs1	UTSW	19	50259752	critical splice donor site	probably null
R5105:Sorcs1	UTSW	19	50225141	missense	possibly damaging	0.57
R5437:Sorcs1	UTSW	19	50252602	missense	probably benign	0.19
R5574:Sorcs1	UTSW	19	50222133	missense	probably damaging	1.00
R5734:Sorcs1	UTSW	19	50182775	missense	probably benign	0.04
R6045:Sorcs1	UTSW	19	50190117	nonsense	probably null
R6091:Sorcs1	UTSW	19	50288101	missense	possibly damaging	0.64
R6119:Sorcs1	UTSW	19	50288094	missense	probably damaging	0.98
R6226:Sorcs1	UTSW	19	50181414	missense	probably damaging	1.00
R6337:Sorcs1	UTSW	19	50144124	missense	probably benign	0.00
R6378:Sorcs1	UTSW	19	50225177	missense	possibly damaging	0.57
R6782:Sorcs1	UTSW	19	50176122	nonsense	probably null
R6792:Sorcs1	UTSW	19	50678168	missense	probably benign
R6891:Sorcs1	UTSW	19	50225119	nonsense	probably null
R7151:Sorcs1	UTSW	19	50312982	missense	probably damaging	1.00
R7223:Sorcs1	UTSW	19	50190042	missense	probably benign	0.06
R7356:Sorcs1	UTSW	19	50175157	missense	possibly damaging	0.86
R7471:Sorcs1	UTSW	19	50262263	missense	probably damaging	1.00
R7474:Sorcs1	UTSW	19	50153112	missense	possibly damaging	0.65
R7503:Sorcs1	UTSW	19	50153052	missense	probably benign
R7506:Sorcs1	UTSW	19	50182674	nonsense	probably null
R7573:Sorcs1	UTSW	19	50152796	nonsense	probably null
X0024:Sorcs1	UTSW	19	50182763	missense	possibly damaging	0.92
Z1088:Sorcs1	UTSW	19	50222143	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- GCTTGAAACCAGAGATGGCTGACTTG -3'
(R):5'- CCTGCTTTGCCAGTGTTAGGGAAAC -3'

Sequencing Primer
(F):5'- TCATAGAACACCTCTCCTTGTAAC -3'
(R):5'- ctctaagaagcaggggacac -3'

Posted On

2013-04-11