Incidental Mutation 'R0115:Sorcs1'
ID 20761
Institutional Source Beutler Lab
Gene Symbol Sorcs1
Ensembl Gene ENSMUSG00000043531
Gene Name sortilin-related VPS10 domain containing receptor 1
Synonyms
MMRRC Submission 038401-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R0115 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 19
Chromosomal Location 50131737-50667084 bp(-) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) A to G at 50624891 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072685] [ENSMUST00000111756] [ENSMUST00000164039] [ENSMUST00000209413] [ENSMUST00000209783] [ENSMUST00000211008] [ENSMUST00000211687]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000072685
SMART Domains Protein: ENSMUSP00000072472
Gene: ENSMUSG00000043531

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111756
SMART Domains Protein: ENSMUSP00000107386
Gene: ENSMUSG00000043531

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164039
SMART Domains Protein: ENSMUSP00000132615
Gene: ENSMUSG00000043531

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
low complexity region 1129 1142 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209413
Predicted Effect probably benign
Transcript: ENSMUST00000209783
Predicted Effect probably benign
Transcript: ENSMUST00000211008
Predicted Effect probably benign
Transcript: ENSMUST00000211687
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.2%
  • 20x: 86.0%
Validation Efficiency 98% (98/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. Two of the five family members (sortilin and sortilin-related receptor) are synthesized as preproproteins; it is not yet known if this encoded protein is also a preproprotein. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Female mice homozygous for a null allele have abnormal amyloid beta levels in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik A G 9: 114,108,452 (GRCm39) noncoding transcript Het
Alas1 A T 9: 106,115,451 (GRCm39) probably null Het
Arf5 A G 6: 28,426,075 (GRCm39) Y154C probably damaging Het
Arhgap20 T A 9: 51,750,272 (GRCm39) I344N probably damaging Het
Arhgap30 A C 1: 171,235,516 (GRCm39) E630A possibly damaging Het
B4galt5 A G 2: 167,151,154 (GRCm39) L118P probably damaging Het
Bdp1 A G 13: 100,177,962 (GRCm39) I1969T probably benign Het
Bysl C T 17: 47,921,867 (GRCm39) R77Q probably benign Het
Cap1 A T 4: 122,756,868 (GRCm39) H272Q possibly damaging Het
Ccdc146 T C 5: 21,527,754 (GRCm39) I187M possibly damaging Het
Ccdc192 G A 18: 57,727,214 (GRCm39) probably benign Het
Cdhr18 A G 14: 13,899,571 (GRCm38) V117A probably damaging Het
Cdk13 C A 13: 17,894,079 (GRCm39) A1123S probably damaging Het
Ces5a A T 8: 94,228,811 (GRCm39) M473K probably damaging Het
Chd8 A G 14: 52,474,663 (GRCm39) S123P probably benign Het
Cwc22 G A 2: 77,738,455 (GRCm39) A497V probably damaging Het
Cwh43 T C 5: 73,575,370 (GRCm39) S296P probably damaging Het
Cyp2c50 T A 19: 40,080,837 (GRCm39) probably benign Het
Dlg1 C A 16: 31,624,508 (GRCm39) Y399* probably null Het
Drosha A T 15: 12,846,216 (GRCm39) E92D probably benign Het
Fanca C T 8: 123,995,278 (GRCm39) G1408D probably benign Het
Frem1 T A 4: 82,854,406 (GRCm39) D1621V possibly damaging Het
Frem2 G A 3: 53,563,629 (GRCm39) R293C probably damaging Het
Fut8 T A 12: 77,495,334 (GRCm39) V308D probably damaging Het
Glipr1 A G 10: 111,829,446 (GRCm39) I105T probably benign Het
Glmn A T 5: 107,708,800 (GRCm39) S385T probably benign Het
Gon4l T A 3: 88,802,989 (GRCm39) V1200D probably damaging Het
Gpc1 G A 1: 92,785,221 (GRCm39) D387N probably damaging Het
Gsdmc A G 15: 63,675,486 (GRCm39) Y110H probably damaging Het
Gucy1b1 T A 3: 81,941,698 (GRCm39) H586L probably benign Het
Gucy2e A G 11: 69,127,458 (GRCm39) L5P unknown Het
Hectd4 A G 5: 121,433,569 (GRCm39) probably benign Het
Hmcn1 T A 1: 150,684,398 (GRCm39) I391F possibly damaging Het
Hsf4 A T 8: 105,999,336 (GRCm39) probably null Het
I830077J02Rik G A 3: 105,833,886 (GRCm39) T90M probably damaging Het
Ino80 A T 2: 119,261,497 (GRCm39) H722Q probably damaging Het
Kcnma1 C A 14: 23,364,243 (GRCm39) R980L probably damaging Het
Kif1a A G 1: 92,974,500 (GRCm39) probably benign Het
Klhdc7b A G 15: 89,272,724 (GRCm39) H1202R probably benign Het
Lig3 A G 11: 82,684,761 (GRCm39) D559G probably damaging Het
Lyst T C 13: 13,852,537 (GRCm39) V2179A probably benign Het
Mab21l4 A T 1: 93,087,447 (GRCm39) S135R possibly damaging Het
Mansc4 A G 6: 146,976,725 (GRCm39) I297T possibly damaging Het
Marchf6 A T 15: 31,475,958 (GRCm39) F633I probably benign Het
Marf1 C T 16: 13,960,398 (GRCm39) A549T probably damaging Het
Megf10 G T 18: 57,392,874 (GRCm39) V424L possibly damaging Het
Mfsd13a C T 19: 46,354,943 (GRCm39) T40I probably benign Het
Mib2 A G 4: 155,740,519 (GRCm39) probably benign Het
Mmut C T 17: 41,267,118 (GRCm39) T564M probably damaging Het
Myh8 A G 11: 67,197,090 (GRCm39) probably benign Het
Mypn T C 10: 63,028,159 (GRCm39) probably benign Het
Nf1 G A 11: 79,359,702 (GRCm39) probably null Het
Notch3 T A 17: 32,352,436 (GRCm39) T1866S possibly damaging Het
Or1e30 A G 11: 73,678,141 (GRCm39) I126V possibly damaging Het
Or1o11 C T 17: 37,756,670 (GRCm39) A86V probably benign Het
Or4c102 A T 2: 88,422,999 (GRCm39) I284F probably damaging Het
Or4k51 T A 2: 111,584,930 (GRCm39) M112K probably damaging Het
Pkhd1 A T 1: 20,420,714 (GRCm39) I2464N probably damaging Het
Pkn1 A G 8: 84,397,658 (GRCm39) S817P probably damaging Het
Prkg2 A T 5: 99,142,514 (GRCm39) probably null Het
Prl8a6 T C 13: 27,617,084 (GRCm39) D201G probably benign Het
Psmd1 C T 1: 86,010,993 (GRCm39) T356I possibly damaging Het
Ptk6 G A 2: 180,844,320 (GRCm39) probably benign Het
Ptprn2 T C 12: 117,175,466 (GRCm39) probably benign Het
Rbm42 G A 7: 30,347,200 (GRCm39) T106I probably damaging Het
Rims4 A T 2: 163,706,040 (GRCm39) V198E probably damaging Het
Ripk1 T C 13: 34,193,733 (GRCm39) S32P probably damaging Het
Rorc T C 3: 94,284,916 (GRCm39) probably benign Het
Rpl22l1 T C 3: 28,860,685 (GRCm39) F15L probably damaging Het
Slc6a20a C A 9: 123,507,823 (GRCm39) A17S possibly damaging Het
Sp100 A G 1: 85,577,852 (GRCm39) probably benign Het
Ssc5d G A 7: 4,930,880 (GRCm39) probably benign Het
Taf11 A G 17: 28,126,635 (GRCm39) L4P probably benign Het
Tm2d3 A G 7: 65,345,082 (GRCm39) probably benign Het
Tmub2 T C 11: 102,179,201 (GRCm39) probably null Het
Trim34a T A 7: 103,897,109 (GRCm39) C58S probably damaging Het
Trpc3 T C 3: 36,678,566 (GRCm39) I840V probably benign Het
Trpm6 T C 19: 18,807,316 (GRCm39) V1020A probably damaging Het
Vmn1r214 T A 13: 23,219,464 (GRCm39) Y319* probably null Het
Vmn1r59 T C 7: 5,457,115 (GRCm39) N215S probably benign Het
Vmn2r74 T C 7: 85,606,564 (GRCm39) M261V probably benign Het
Vmn2r89 T C 14: 51,693,577 (GRCm39) F309S probably damaging Het
Wdr95 A T 5: 149,487,855 (GRCm39) D163V probably damaging Het
Xirp2 T A 2: 67,340,253 (GRCm39) F831L possibly damaging Het
Ythdc2 C T 18: 44,974,490 (GRCm39) probably benign Het
Other mutations in Sorcs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Sorcs1 APN 19 50,178,492 (GRCm39) missense probably damaging 1.00
IGL00983:Sorcs1 APN 19 50,164,566 (GRCm39) missense probably damaging 0.98
IGL01125:Sorcs1 APN 19 50,216,639 (GRCm39) missense probably damaging 1.00
IGL01320:Sorcs1 APN 19 50,276,517 (GRCm39) splice site probably benign
IGL01445:Sorcs1 APN 19 50,141,504 (GRCm39) missense probably damaging 1.00
IGL01682:Sorcs1 APN 19 50,169,944 (GRCm39) missense probably benign 0.43
IGL01799:Sorcs1 APN 19 50,218,647 (GRCm39) critical splice donor site probably null
IGL02044:Sorcs1 APN 19 50,276,597 (GRCm39) splice site probably benign
IGL02111:Sorcs1 APN 19 50,218,683 (GRCm39) missense probably benign 0.00
IGL02364:Sorcs1 APN 19 50,322,036 (GRCm39) missense probably damaging 1.00
IGL02378:Sorcs1 APN 19 50,171,109 (GRCm39) nonsense probably null
IGL02498:Sorcs1 APN 19 50,666,606 (GRCm39) missense probably benign
IGL02658:Sorcs1 APN 19 50,178,530 (GRCm39) missense probably damaging 1.00
IGL02939:Sorcs1 APN 19 50,666,368 (GRCm39) nonsense probably null
IGL02942:Sorcs1 APN 19 50,463,875 (GRCm39) missense probably damaging 1.00
IGL03057:Sorcs1 APN 19 50,248,194 (GRCm39) nonsense probably null
IGL03230:Sorcs1 APN 19 50,230,531 (GRCm39) missense probably damaging 1.00
P0033:Sorcs1 UTSW 19 50,141,345 (GRCm39) missense probably damaging 0.98
R0109:Sorcs1 UTSW 19 50,367,329 (GRCm39) splice site probably benign
R0242:Sorcs1 UTSW 19 50,216,659 (GRCm39) missense probably damaging 1.00
R0242:Sorcs1 UTSW 19 50,216,659 (GRCm39) missense probably damaging 1.00
R0325:Sorcs1 UTSW 19 50,301,480 (GRCm39) splice site probably null
R0481:Sorcs1 UTSW 19 50,624,891 (GRCm39) intron probably benign
R0581:Sorcs1 UTSW 19 50,241,139 (GRCm39) missense possibly damaging 0.70
R0669:Sorcs1 UTSW 19 50,230,380 (GRCm39) splice site probably benign
R0980:Sorcs1 UTSW 19 50,220,761 (GRCm39) missense probably benign 0.04
R1158:Sorcs1 UTSW 19 50,132,598 (GRCm39) unclassified probably benign
R1519:Sorcs1 UTSW 19 50,241,025 (GRCm39) missense probably benign 0.05
R1669:Sorcs1 UTSW 19 50,463,860 (GRCm39) missense probably damaging 0.99
R1779:Sorcs1 UTSW 19 50,163,481 (GRCm39) splice site probably benign
R1783:Sorcs1 UTSW 19 50,216,747 (GRCm39) critical splice acceptor site probably null
R1927:Sorcs1 UTSW 19 50,210,633 (GRCm39) missense probably damaging 1.00
R1935:Sorcs1 UTSW 19 50,221,082 (GRCm39) missense probably damaging 0.96
R1936:Sorcs1 UTSW 19 50,221,082 (GRCm39) missense probably damaging 0.96
R2109:Sorcs1 UTSW 19 50,666,630 (GRCm39) missense probably benign
R2206:Sorcs1 UTSW 19 50,218,655 (GRCm39) missense possibly damaging 0.81
R2207:Sorcs1 UTSW 19 50,218,655 (GRCm39) missense possibly damaging 0.81
R3031:Sorcs1 UTSW 19 50,213,613 (GRCm39) missense probably damaging 0.98
R3032:Sorcs1 UTSW 19 50,213,613 (GRCm39) missense probably damaging 0.98
R3107:Sorcs1 UTSW 19 50,199,088 (GRCm39) missense possibly damaging 0.83
R3508:Sorcs1 UTSW 19 50,213,613 (GRCm39) missense probably damaging 0.98
R3738:Sorcs1 UTSW 19 50,139,659 (GRCm39) missense probably benign 0.03
R4127:Sorcs1 UTSW 19 50,210,597 (GRCm39) missense probably benign 0.29
R4212:Sorcs1 UTSW 19 50,213,613 (GRCm39) missense probably damaging 0.98
R4213:Sorcs1 UTSW 19 50,213,613 (GRCm39) missense probably damaging 0.98
R4385:Sorcs1 UTSW 19 50,178,599 (GRCm39) missense probably benign 0.01
R4424:Sorcs1 UTSW 19 50,367,379 (GRCm39) missense probably damaging 0.97
R4603:Sorcs1 UTSW 19 50,301,402 (GRCm39) critical splice donor site probably null
R4679:Sorcs1 UTSW 19 50,171,107 (GRCm39) missense probably benign
R4780:Sorcs1 UTSW 19 50,132,419 (GRCm39) unclassified probably benign
R4781:Sorcs1 UTSW 19 50,171,119 (GRCm39) missense probably damaging 1.00
R4823:Sorcs1 UTSW 19 50,218,740 (GRCm39) missense possibly damaging 0.87
R4823:Sorcs1 UTSW 19 50,666,578 (GRCm39) missense possibly damaging 0.92
R4883:Sorcs1 UTSW 19 50,220,741 (GRCm39) missense probably benign 0.00
R5091:Sorcs1 UTSW 19 50,248,190 (GRCm39) critical splice donor site probably null
R5105:Sorcs1 UTSW 19 50,213,579 (GRCm39) missense possibly damaging 0.57
R5437:Sorcs1 UTSW 19 50,241,040 (GRCm39) missense probably benign 0.19
R5574:Sorcs1 UTSW 19 50,210,571 (GRCm39) missense probably damaging 1.00
R5734:Sorcs1 UTSW 19 50,171,213 (GRCm39) missense probably benign 0.04
R6045:Sorcs1 UTSW 19 50,178,555 (GRCm39) nonsense probably null
R6091:Sorcs1 UTSW 19 50,276,539 (GRCm39) missense possibly damaging 0.64
R6119:Sorcs1 UTSW 19 50,276,532 (GRCm39) missense probably damaging 0.98
R6226:Sorcs1 UTSW 19 50,169,852 (GRCm39) missense probably damaging 1.00
R6337:Sorcs1 UTSW 19 50,132,562 (GRCm39) missense probably benign 0.00
R6378:Sorcs1 UTSW 19 50,213,615 (GRCm39) missense possibly damaging 0.57
R6782:Sorcs1 UTSW 19 50,164,560 (GRCm39) nonsense probably null
R6792:Sorcs1 UTSW 19 50,666,606 (GRCm39) missense probably benign
R6891:Sorcs1 UTSW 19 50,213,557 (GRCm39) nonsense probably null
R7151:Sorcs1 UTSW 19 50,301,420 (GRCm39) missense probably damaging 1.00
R7223:Sorcs1 UTSW 19 50,178,480 (GRCm39) missense probably benign 0.06
R7356:Sorcs1 UTSW 19 50,163,595 (GRCm39) missense possibly damaging 0.86
R7471:Sorcs1 UTSW 19 50,250,701 (GRCm39) missense probably damaging 1.00
R7474:Sorcs1 UTSW 19 50,141,550 (GRCm39) missense possibly damaging 0.65
R7503:Sorcs1 UTSW 19 50,141,490 (GRCm39) missense probably benign
R7506:Sorcs1 UTSW 19 50,171,112 (GRCm39) nonsense probably null
R7573:Sorcs1 UTSW 19 50,141,234 (GRCm39) nonsense probably null
R7867:Sorcs1 UTSW 19 50,218,698 (GRCm39) nonsense probably null
R7911:Sorcs1 UTSW 19 50,132,470 (GRCm39) missense unknown
R8032:Sorcs1 UTSW 19 50,463,846 (GRCm39) missense probably benign 0.28
R8063:Sorcs1 UTSW 19 50,132,415 (GRCm39) missense unknown
R8463:Sorcs1 UTSW 19 50,248,248 (GRCm39) missense probably damaging 1.00
R8682:Sorcs1 UTSW 19 50,367,398 (GRCm39) missense probably damaging 0.99
R8724:Sorcs1 UTSW 19 50,139,658 (GRCm39) missense probably benign 0.33
R8926:Sorcs1 UTSW 19 50,241,096 (GRCm39) missense possibly damaging 0.94
R9160:Sorcs1 UTSW 19 50,213,658 (GRCm39) missense probably damaging 1.00
R9173:Sorcs1 UTSW 19 50,220,753 (GRCm39) missense possibly damaging 0.92
R9203:Sorcs1 UTSW 19 50,250,733 (GRCm39) missense probably damaging 1.00
R9229:Sorcs1 UTSW 19 50,141,300 (GRCm39) missense probably benign 0.17
R9398:Sorcs1 UTSW 19 50,213,651 (GRCm39) missense possibly damaging 0.90
R9430:Sorcs1 UTSW 19 50,199,208 (GRCm39) missense probably damaging 1.00
R9510:Sorcs1 UTSW 19 50,666,521 (GRCm39) missense probably benign 0.04
R9511:Sorcs1 UTSW 19 50,666,521 (GRCm39) missense probably benign 0.04
R9744:Sorcs1 UTSW 19 50,215,275 (GRCm39) missense probably damaging 1.00
R9777:Sorcs1 UTSW 19 50,248,190 (GRCm39) critical splice donor site probably null
X0024:Sorcs1 UTSW 19 50,171,201 (GRCm39) missense possibly damaging 0.92
Z1088:Sorcs1 UTSW 19 50,210,581 (GRCm39) missense probably benign 0.16
Z1177:Sorcs1 UTSW 19 50,322,037 (GRCm39) missense probably damaging 1.00
Z1177:Sorcs1 UTSW 19 50,215,180 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GCTTGAAACCAGAGATGGCTGACTTG -3'
(R):5'- CCTGCTTTGCCAGTGTTAGGGAAAC -3'

Sequencing Primer
(F):5'- TCATAGAACACCTCTCCTTGTAAC -3'
(R):5'- ctctaagaagcaggggacac -3'
Posted On 2013-04-11