Incidental Mutation 'R1845:Gyg'
ID207620
Institutional Source Beutler Lab
Gene Symbol Gyg
Ensembl Gene ENSMUSG00000019528
Gene Nameglycogenin
Synonyms
MMRRC Submission 039870-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.433) question?
Stock #R1845 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location20122084-20155317 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20151122 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 94 (V94D)
Ref Sequence ENSEMBL: ENSMUSP00000114019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118015] [ENSMUST00000178328]
Predicted Effect probably damaging
Transcript: ENSMUST00000118015
AA Change: V94D

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114019
Gene: ENSMUSG00000019528
AA Change: V94D

DomainStartEndE-ValueType
Pfam:Glyco_transf_8 50 163 1.7e-9 PFAM
Pfam:Glyco_transf_8 160 268 1.6e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000178328
AA Change: V50D

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000136035
Gene: ENSMUSG00000019528
AA Change: V50D

DomainStartEndE-ValueType
Pfam:Glyco_transf_8 6 224 2.7e-46 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000184552
AA Change: V71D
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glycogenin family. Glycogenin is a glycosyltransferase that catalyzes the formation of a short glucose polymer from uridine diphosphate glucose in an autoglucosylation reaction. This reaction is followed by elongation and branching of the polymer, catalyzed by glycogen synthase and branching enzyme, to form glycogen. This gene is expressed in muscle and other tissues. Mutations in this gene result in glycogen storage disease XV. This gene has pseudogenes on chromosomes 1, 8 and 13 respectively. Alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T A 12: 55,304,332 I142N possibly damaging Het
1110038F14Rik CGGG CGGGGGG 15: 76,949,663 probably benign Het
Abca17 A T 17: 24,267,716 C1446S probably damaging Het
Asb16 C A 11: 102,276,756 A316E possibly damaging Het
Axdnd1 C T 1: 156,376,544 V384I possibly damaging Het
BC024139 A T 15: 76,125,261 L207* probably null Het
Bcl3 T G 7: 19,809,627 S305R probably damaging Het
Cachd1 T C 4: 100,777,358 V77A probably benign Het
Cd101 C T 3: 101,029,448 probably null Het
Cela1 T C 15: 100,685,167 N64S probably benign Het
Cep128 T C 12: 91,289,598 D366G probably benign Het
Col12a1 A G 9: 79,697,541 V675A probably benign Het
Copg1 A G 6: 87,893,818 Y201C probably damaging Het
Cyp24a1 T C 2: 170,487,917 R372G probably benign Het
Dcaf1 A C 9: 106,851,962 I567L probably benign Het
Dcn A G 10: 97,506,674 D164G probably benign Het
Dnase2a T A 8: 84,909,322 H113Q probably benign Het
Espl1 T C 15: 102,299,013 V304A probably benign Het
Fam193a A G 5: 34,443,372 D315G possibly damaging Het
Fkbp8 T A 8: 70,531,035 probably null Het
Foxp4 T A 17: 47,877,959 T321S probably null Het
Fut10 A G 8: 31,236,300 N361S probably damaging Het
Gm13762 A G 2: 88,973,138 V251A probably benign Het
Has2 T C 15: 56,668,578 K247R probably damaging Het
Helz2 G T 2: 181,232,085 D2205E probably benign Het
Hps6 T A 19: 46,004,970 S449T probably benign Het
Ints10 T C 8: 68,794,671 Y64H probably damaging Het
Kalrn T C 16: 34,356,961 H278R probably damaging Het
Klhdc8a T C 1: 132,303,810 V280A possibly damaging Het
Klk1b5 A G 7: 44,220,125 M210V probably benign Het
Kmt2c G A 5: 25,373,436 A614V probably benign Het
Lck T A 4: 129,558,086 I45F probably benign Het
Lin7a A C 10: 107,412,059 E75A probably damaging Het
Lrp1 A T 10: 127,578,673 C1070S probably damaging Het
Mapk8ip3 G T 17: 24,914,583 N289K probably benign Het
Mbtps1 T C 8: 119,522,493 D686G probably benign Het
Mknk1 T A 4: 115,873,231 C178* probably null Het
Mtmr6 A G 14: 60,296,735 N474S probably damaging Het
Mvb12b A G 2: 33,840,157 probably null Het
Myh6 T C 14: 54,944,674 K1759R probably damaging Het
Nfatc1 T C 18: 80,635,531 K881E possibly damaging Het
Nlrp10 A G 7: 108,927,041 F30S probably damaging Het
Nop14 G T 5: 34,650,328 A430E possibly damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr1212 A G 2: 88,958,867 I134V probably damaging Het
Olfr347 A T 2: 36,734,842 I174F probably damaging Het
Olfr775 A G 10: 129,250,594 E20G probably benign Het
Olfr794 A T 10: 129,571,348 Q231L probably damaging Het
Olfr829 A T 9: 18,857,486 Y287F possibly damaging Het
Osbpl7 C A 11: 97,059,128 S378R probably damaging Het
Otof A T 5: 30,371,723 Y1775* probably null Het
Parp16 T C 9: 65,215,594 S46P possibly damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pi16 A T 17: 29,319,387 Q58L possibly damaging Het
Pld3 C A 7: 27,539,452 M190I probably benign Het
Plscr4 T G 9: 92,490,046 I290S probably damaging Het
Ppip5k2 T C 1: 97,723,806 D928G possibly damaging Het
Ppp1r13l T A 7: 19,368,611 L15Q probably damaging Het
Ptpn14 C A 1: 189,839,502 S263R possibly damaging Het
Sema7a G A 9: 57,954,899 V178I possibly damaging Het
Sesn2 A T 4: 132,497,070 Y342* probably null Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sltm A G 9: 70,543,032 N38S possibly damaging Het
Smg1 T C 7: 118,154,622 probably benign Het
Spsb1 A T 4: 149,906,910 V67E probably damaging Het
Suox A G 10: 128,670,539 V540A possibly damaging Het
Tbc1d12 T A 19: 38,911,085 I483N probably damaging Het
Tbcb A T 7: 30,224,499 D198E possibly damaging Het
Tbce T C 13: 14,019,709 K122E probably benign Het
Tcap T A 11: 98,384,379 L113H probably damaging Het
Thsd7a A T 6: 12,321,041 I1545N probably damaging Het
Tmed10 T C 12: 85,374,503 T55A possibly damaging Het
Tmem268 T A 4: 63,579,943 V200D probably damaging Het
Tmem45b A C 9: 31,431,355 I50M probably damaging Het
Trp53bp2 T C 1: 182,458,903 W1103R probably damaging Het
Ttn C T 2: 76,764,033 V20524M probably damaging Het
Ulk2 A T 11: 61,812,738 N379K probably benign Het
Vmn1r59 A G 7: 5,454,554 V69A probably benign Het
Vmn2r10 A T 5: 109,001,995 Y394* probably null Het
Zfp212 T C 6: 47,931,541 S485P probably benign Het
Zfp512b A T 2: 181,585,735 C776S probably damaging Het
Zfp518b A G 5: 38,671,741 Y974H probably damaging Het
Other mutations in Gyg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Gyg APN 3 20151047 missense probably benign 0.22
R1698:Gyg UTSW 3 20138051 missense probably benign 0.03
R2207:Gyg UTSW 3 20150539 missense probably damaging 1.00
R3930:Gyg UTSW 3 20155025 missense probably benign 0.26
R4206:Gyg UTSW 3 20152737 missense probably benign 0.00
R5040:Gyg UTSW 3 20122659 utr 3 prime probably benign
Predicted Primers PCR Primer
(F):5'- AGCAGGTCTCCCTTACTATGC -3'
(R):5'- TGTGTTCTGAAGTGCATAAAGACAG -3'

Sequencing Primer
(F):5'- ATGCACATCTTTTCAGCCCTTAAAG -3'
(R):5'- CAGATGTAAGAGGGTAGACTATGTC -3'
Posted On2014-06-23